Busch Lab

ZMP

si:dkey-92k1.12

Ensembl ID:
ENSDARG00000073707
ZFIN ID:
ZDB-GENE-030131-8048
Human Orthologue:
CNKSR2
Human Description:
connector enhancer of kinase suppressor of Ras 2 [Source:HGNC Symbol;Acc:19701]
Mouse Orthologue:
Cnksr2
Mouse Description:
connector enhancer of kinase suppressor of Ras 2 Gene [Source:MGI Symbol;Acc:MGI:2661175]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa23944 Nonsense Available for shipment Available now
sa23943 Nonsense Available for shipment Available now
sa29600 Essential Splice Site Available for shipment Available now
sa43650 Nonsense Mutation detected in F1 DNA Not yet available
sa39329 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4144
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110923 Nonsense 26 963 2 22

The following transcripts of ENSDARG00000073707 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 24770693)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25456367
GRCz11 21 25492972
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGATGTCTTCATTTGTCTGTGTCTGTCTTTCTTTAAGGCTTRGATGACTG[T/A]CTGCAGCAGTACATTAAGAACTTTGAGCAGGAGAAGGTTGGCGGTGAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23944
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110923 Nonsense 36 963 2 22

The following transcripts of ENSDARG00000073707 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 24770665)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25456339
GRCz11 21 25492944
KASP Assay ID:
2261-5659.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTTTAAGGCTTGGATGACTGTCTGCAGCAGTACATTAAGAACTTTGAG[C/T]AGGAGAAGGTTGGCGGTGAGCAGCTGTTGAGAATCACGCATCAGGAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23943
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110923 Nonsense 74 963 2 22

The following transcripts of ENSDARG00000073707 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 24770549)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25456223
GRCz11 21 25492828
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCGAATCGGCCACCAGGAGCTCATTCTGGAGGCCGTGGACCTGTTGTG[T/A]GCGCTGGTGAGCTCCTACACAAACACATACCAAAGACAAACTGAATCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29600
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110923 Essential Splice Site 144 963 3 22

The following transcripts of ENSDARG00000073707 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 24762023)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25447697
GRCz11 21 25484302
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGTGGACCTCATCGCTGCCGCCAAGAGCCTGCTGGCATGGCTGGATAGG[T/C]TAGTCTTGCAAAGAGACACAAATACACACTTAAACAGACACAAACAGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43650
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110923 Nonsense 183 963 5 22

The following transcripts of ENSDARG00000073707 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 24747854)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25433528
GRCz11 21 25470133
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTTTCTTTTCTTGCCTTTCAGGACGGCACAGTGTATGAGACCGAGAAT[A/T]AGATACTGCATGTGGTAAGACTGACATTTATTTTCTCACACAATCTCAAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29599
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110923 Essential Splice Site 271 963 None 22

The following transcripts of ENSDARG00000073707 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 24738570)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25424244
GRCz11 21 25460849
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTCTCCCAATCTAAAGCAATGAGATGAACACATGTGTTTGTTTTGTGC[A/G]GGTGGGCTGGCAGCTGAAGAACCTGGTTAACTCTTTACGGAGCAACCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39329
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110923 Essential Splice Site 947 963 21 22

The following transcripts of ENSDARG00000073707 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 24706648)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25392322
GRCz11 21 25428927
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACTCAACGAGAAACTGCACCGCCTGCGCATCCTGCAAAACTCATTCAAG[G/A]TACAGTAAGCACATGCTGCAGACGGTCAACATTTACACACACACACGCAT
Associated Phenotype:
Not determined