Busch Lab

ZMP

NAV2 (1 of 2)

Ensembl ID:
ENSDARG00000073688
Description:
neuron navigator 2 [Source:HGNC Symbol;Acc:15997]
Human Orthologue:
NAV2
Human Description:
neuron navigator 2 [Source:HGNC Symbol;Acc:15997]
Mouse Orthologue:
Nav2
Mouse Description:
neuron navigator 2 Gene [Source:MGI Symbol;Acc:MGI:2183691]

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa15972 Nonsense Available for shipment Available now
sa40851 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa30884 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa34024 Nonsense Mutation detected in F1 DNA Not yet available
sa7061 Nonsense Mutation detected in F1 DNA Not yet available
sa15602 Nonsense Available for shipment Available now
sa10172 Nonsense Available for shipment Available now
sa9986 Essential Splice Site Available for shipment Available now
sa31554 Essential Splice Site Available for shipment Available now
sa25358 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa15972
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113332 Nonsense 56 2347 1 37
Genomic Location (Zv9):
Chromosome 7 (position 17581878)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 16554667
GRCz11 7 16806640
KASP Assay ID:
2259-8566.1 (used for ordering genotyping assays)
KASP Sequence:
AGCCCCCYRCAGAGCAGCGCTCATCTCCACCTCCAGAGCCAAAGYGGGTG[G/A]ATGACAAGCAAAAACTATCRCAATGTTGACAGTGGAGAGGACACACAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40851
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113332 Essential Splice Site 267 2347 6 37
ENSDART00000113332 Essential Splice Site 267 2347 6 37
Genomic Location (Zv9):
Chromosome 7 (position 17680574)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 16653363
GRCz11 7 16905336
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTCTGGTGTTCAGCGATAAAGCCAAACCTGCAGCAGCTCAGGCCAAAG[G/A]TAAACACAACTGAATTACTTTAGCTGAACACTGCACTTGCAGACTCATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30884
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113332 Essential Splice Site 267 2347 6 37
ENSDART00000113332 Essential Splice Site 267 2347 6 37
Genomic Location (Zv9):
Chromosome 7 (position 17680574)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 16653363
GRCz11 7 16905336
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTCTGGTGTTCAGCGATAAAGCCAAACCTGCAGCAGCTCAGGCCAAAG[G/A]TAAACACAACTGAATTACTTTAGCTGAACACTGCACTTGCAGACTCATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34024
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113332 Nonsense 459 2347 7 37
Genomic Location (Zv9):
Chromosome 7 (position 17691323)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 16664112
GRCz11 7 16916085
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGCGAAATCTTCAGAGAAAGAAAAGGGCAAAGACAAAAATGCATCCAAG[C/T]GAGGCTCTCCTTCAGAAAAGGTAGAGGAGGTCAAGGAAGAAGTGGTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7061
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113332 Nonsense 684 2347 9 37
Genomic Location (Zv9):
Chromosome 7 (position 17694429)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 16667218
GRCz11 7 16919191
KASP Assay ID:
554-4569.1 (used for ordering genotyping assays)
KASP Sequence:
GGCGCCTGAGGACTGTCAAAAACATCGCTGACCTGCGGCARAATYTAGAA[G/T]AAACCATGTCCAGTTTACGGGGGACACAAATCACTCACAGGTAGACANTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15602
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113332 Nonsense 765 2347 10 37
Genomic Location (Zv9):
Chromosome 7 (position 17697513)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 16670302
GRCz11 7 16922275
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATGGGTATCAGTCCYGCAGCGGRGGGGTTGCAYCCGGCCAGGGCCGCTA[T/A]CTGTATCAGGCTCCCCTACGGAAGCAGCTGGCAGCACGCGGCAGTGGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10172
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113332 Nonsense 1024 2347 14 37
Genomic Location (Zv9):
Chromosome 7 (position 17732811)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 16705600
GRCz11 7 16957573
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTMATCCRTTAGGCAAAACAGATGACGCCAAGGTYTCGGAAAAAGGTYG[C/A]ATGTCTCCCTCTTCCAACATCCTTCAGCATTCCTCCTCRGACACYGGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9986
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113332 Essential Splice Site 1695 2347 25 37
Genomic Location (Zv9):
Chromosome 7 (position 17774394)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 16747183
GRCz11 7 16999156
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTGTTTTTCAGKAACTCTAGACTCATGACCTGTCTCTGTTATCATTGCA[G/A]CTTCGCAGCTCCTTCAAACAGGCCTTCAGTAAGAAGAAATCCCCTAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31554
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113332 Essential Splice Site 1923 2347 29 37
Genomic Location (Zv9):
Chromosome 7 (position 17779695)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 16752484
GRCz11 7 17004457
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAAACCAAGTGGGATGTTCTCGATGGAGTTGTACGGCGCTTGTTTAAGG[T/G]AAATACATTTATAATAATTATTTGATGAGGATGAGTCATTTACATTACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25358
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113332 Nonsense 2106 2347 32 37
Genomic Location (Zv9):
Chromosome 7 (position 17783550)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 16756339
GRCz11 7 17008312
KASP Assay ID:
554-7786.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCACCACATCAGCTCACTGGGAGAGATCTTCAGTGGCCTCCTCAATTGC[A/T]GATACCAGCGCTGGTCAGTCAGCATTTATAAACACACTACCATTCAAACA
Associated Phenotype:
Not determined