Busch Lab

ZMP

LOC559723

Ensembl ID:
ENSDARG00000071879
Human Orthologue:
TGFB2
Human Description:
transforming growth factor, beta 2 [Source:HGNC Symbol;Acc:11768]
Mouse Orthologue:
Tgfb2
Mouse Description:
transforming growth factor, beta 2 Gene [Source:MGI Symbol;Acc:MGI:98726]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa42348 Nonsense Mutation detected in F1 DNA Not yet available
sa13400 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42348
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106671 Nonsense 203 418 3 7
Genomic Location (Zv9):
Chromosome 14 (position 8762347)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 8485591
GRCz11 14 8791705
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGAGGTACATCGACTCCAGAACGGTGGAGCCTCGAGCCAAGGGAGCGTG[G/A]CTTTCTGTGGACGTCACAGAGACTGTGAAGGAGTGGATGGCGTTCAGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13400
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106671 Nonsense 346 418 6 7
Genomic Location (Zv9):
Chromosome 14 (position 8752860)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 8476104
GRCz11 14 8782218
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTTCCGCCGGGACTTGAACTGGAAGTGGATCCACGAACCCAAAGGCTAT[A/T]AAGCAAATTTCTGCGCAGGGAACTGTCCTTACCTGTGGAGTGCRGACAAC
Associated Phenotype:
Not determined