Busch Lab

ZMP

zgc:136859

Ensembl ID:
ENSDARG00000071876
ZFIN ID:
ZDB-GENE-060421-6581
Description:
hypothetical protein LOC678542 [Source:RefSeq peptide;Acc:NP_001035391]
Human Orthologue:
RELL2
Human Description:
RELT-like 2 [Source:HGNC Symbol;Acc:26902]
Mouse Orthologue:
Rell2
Mouse Description:
RELT-like 2 Gene [Source:MGI Symbol;Acc:MGI:1918044]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa16678 Nonsense Available for shipment Available now
sa35639 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28266
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063559 Essential Splice Site 65 401 2 5
ENSDART00000134935 Essential Splice Site 65 158 3 5
Genomic Location (Zv9):
Chromosome 14 (position 9639779)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 9161619
GRCz11 14 9467633
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATGATCAAAGATTATTTAAAAAAATATTGAAAATCTCTGTTTTCCCTCC[A/T]GATGTATCAGAAGACAGTCAAGACACTGTGGAACAAATTCTGAAGTGTAT
Long Flanking Sequence:
TAATAATAATAATAATAATAATAATAATGTCATCATTTACTCTTTCCTGATTTGTTCCAAATAATTTTTTAATACAAAAGAAGTTAAATTATAAAATGTTGGAAACCTGTTACCATTGACCTCCATTACATTTGTTTTTCCTACTATGCAATGGTTACTGGTTTCCAGCATTCTCTACTACAAACAAAATGTTGTTATTTTTTTTTGTTTTTTTGGGGGGGGGGTGAACAGTTCCTTTAAACATTGCATGTTATGATTAGTTCACTAGCTATATATGAGAGTAAATTTTGAGGACTCAAAAAGGCAATTTTAATTAATTTAGTTATTTAAATTGATCATCATCTTGATCTAATGGAGGATTTACCCATATGGGCAAAGCCAGGGTTTGACATTAAACAAATCTCCTTAAACTGAACAAACTAAAAGTGTATTGACACATTTTTGTACAATCATGATCAAAGATTATTTAAAAAAATATTGAAAATCTCTGTTTTCCCTCC[A/T]GATGTATCAGAAGACAGTCAAGACACTGTGGAACAAATTCTGAAGTGTATCATTGAGAATGAAGGTACAGAAAAAGTGCATTATTAAATTCTACATCTATTTCAATGACATAAAATGTATGGAGCTGCATTTTATTTATAATCCTTCATGTATTTAAATAGTTTCTTACAACCTTTCTTATGGTTTTGTGTTCCAGCTAATGTGGAGGCCTTCAGAGAGATGTTGGTTGGCCAAAATGTTTGTGAGCATTATGACCCACGGTATAATAATTTAATTATTTACTGTCATAAAAATATAAAAAACAGCCTTCAGGTCACATTTGTCTCATTTTAATTAACATGTGGATTGAAAAGTTGTAGTTAGTACTACTGTAGTTTAAGTCACAATTCATGCTATTACTTCTGGCTTATTATCTATAGTTGAAGTCAGAATTATTAGCCCCCCTTTGATTTTTTTTTTTTTTTTAATATTTCCCAAATGATGTTTAACAGATTAAGGAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4549
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063559 Essential Splice Site 86 401 2 5
ENSDART00000134935 Essential Splice Site 86 158 3 5
Genomic Location (Zv9):
Chromosome 14 (position 9639845)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 9161685
GRCz11 14 9467699
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTCAAGACACTGTGGAACAAATTCTGAAGTGTATCATTGAGAATGAAGG[T/A]ACAGAAAAAGTGCATTATTAAATTCTACATCTATTTCWATGACATAAAAT
Long Flanking Sequence:
TTTTAATACAAAAGAAGTTAAATTATAAAATGTTGGAAACCTGTTACCATTGACCTCCATTACATTTGTTTTTCCTACTATGCAATGGTTACTGGTTTCCAGCATTCTCTACTACAAACAAAATGTTGTTATTTTTTTTTGTTTTTTTGGGGGGGGGGTGAACAGTTCCTTTAAACATTGCATGTTATGATTAGTTCACTAGCTATATATGAGAGTAAATTTTGAGGACTCAAAAAGGCAATTTTAATTAATTTAGTTATTTAAATTGATCATCATCTTGATCTAATGGAGGATTTACCCATATGGGCAAAGCCAGGGTTTGACATTAAACAAATCTCCTTAAACTGAACAAACTAAAAGTGTATTGACACATTTTTGTACAATCATGATCAAAGATTATTTAAAAAAATATTGAAAATCTCTGTTTTCCCTCCAGATGTATCAGAAGACAGTCAAGACACTGTGGAACAAATTCTGAAGTGTATCATTGAGAATGAAGG[T/A]ACAGAAAAAGTGCATTATTAAATTCTACATCTATTTCAATGACATAAAATGTATGGAGCTGCATTTTATTTATAATCCTTCATGTATTTAAATAGTTTCTTACAACCTTTCTTATGGTTTTGTGTTCCAGCTAATGTGGAGGCCTTCAGAGAGATGTTGGTTGGCCAAAATGTTTGTGAGCATTATGACCCACGGTATAATAATTTAATTATTTACTGTCATAAAAATATAAAAAACAGCCTTCAGGTCACATTTGTCTCATTTTAATTAACATGTGGATTGAAAAGTTGTAGTTAGTACTACTGTAGTTTAAGTCACAATTCATGCTATTACTTCTGGCTTATTATCTATAGTTGAAGTCAGAATTATTAGCCCCCCTTTGATTTTTTTTTTTTTTTTAATATTTCCCAAATGATGTTTAACAGATTAAGGAAATTTTCACATTATGTCTGATAATATTTTTTCTTCTGGAGAAAGTCTTATTTGTTTTATTTCGGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16678
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063559 Nonsense 147 401 4 5
ENSDART00000134935 Nonsense 147 158 5 5
Genomic Location (Zv9):
Chromosome 14 (position 9641745)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 9163585
GRCz11 14 9469599
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCAGCTCTTGYRTTCACTGCATGCAAGGACAAATCTTAAAAACGCGACGC[A/T]GAAGCCGCGTGGCCARAAGCAAAGCCCGGCCAGGAGAGCAGACTGTGTTT
Long Flanking Sequence:
GAAAAACTAGGAGAAGCAGTTTTAACATGAAGTGACATGACATCTGACGTACCAACACTGTCTCAAGGCAATTTGTAACTTTTTGATTTAGAGGCTAATTCGTATGAATTCGTACGATCTAATTTGTACAATTTAGTACGATTTGCTCATCCCCCAATGATGGTTGGGTTTAGGGGTGGGGTTAGGTGCCACGCCTTCTTTTTAAAATCGTACAATTTCGTACGACTAAACTTGTACGAATTCGTACGAACTTGCCACTAAACTGGCAAAACGTAAAATACGTTTTCTCGTGAGATCAGGCTTTTTAGTGAAGTGATTTATTTTTTAATTTTTACATTTTTAGTGAAGTAATTTATTTTATAATTATCTTGTTTTCACCCAGGCTGCGTCATAAAGACAGTGTCGGTGGTCTTCCCCTTCACCACCACACAGTTCATCTCGGAGGTGAAATCAGCTCTTGTGTTCACTGCATGCAAGGACAAATCTTAAAAACGCGACGC[A/T]GAAGCCGCGTGGCCAAAAGCAAAGCCCGGCCAGGAGAGCAGACTGTGTTTTCTGTGGGCAGGTGAGACTATTAACTGTGTGAATTACATTATCAGTTAAACCAGTACTGGACAAAGTGTTTTTTTTTTTTAATTTATCAAAACACTACCTAATTAATCAATATCTTCTTCGGATACTAAAGTTTCTATCAAGGAAATTAGACAAAAGAAATAAATATTAGCTGGAGAACCATATTTGTTCAAGGCATAGAGGTAAATAATCAGTTAATATATGAGCAATATCACACGAGTAGCAGTGTGCTATGGCTGTATATCAGCACTGGTGGGAGGCGTGCGCGGCCGAGTGCCTTAGCGCCCCACCAGTGCTGATATACAGCCATACTCGTGTGATGTTGCGTTTATACAACAGTTCGACGGCACAATCTTGTACATAAAAAAGAAAATCAAACACAGAGAGTCTAAAACCCTTTTGTTTTAGGAACTACTTTCTTCCGCCATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35639
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063559 Nonsense 271 401 5 5
ENSDART00000134935 None None 158 None 5
Genomic Location (Zv9):
Chromosome 14 (position 9647017)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 9168857
GRCz11 14 9474871
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGGAGATCAAAGCAGGGCCGGAAGTATTTGTGGAGGACAAAGAAGGAT[C/A]AACCACTGCTGATCAGCTCTCCATCTCACTGGAAGAATGCTTGAGCTCCG
Long Flanking Sequence:
AAATATCTGGCAATGAAGTATAATTAAGATTAGCAAGATTTACAAAAAAACTTATATATTATATAATAATGCTATATTAAATAGTACTTATTACCAACAATACTACTTTTCATATATAAATAGTAATTATTATTAATATTACAATATTAAATATTACTTATTACCAACATTAATTACCTGAATTCACAGATTCCGTGTCACCCACATGGACAAGAGAAACAGCCTTCACGGGTCAATGAATCTTCCTACCCCCAAGCCAGGAAACACATCGAATGACACAACGCTCTCAGACAGCAGGACGGGATTGAAGGAAACTTCACTGAAGTCTCAGGAGGAATACAACATCCGCAACATGTTTAAAGACTCTGGAGCAACTAACGGCAAAGTCCCAAATGTAGGCAAACGGAAGAAGAGTGTGACTTTGCTGGGCTTTTACAAGACTAGTAGTCCTGTGGAGATCAAAGCAGGGCCGGAAGTATTTGTGGAGGACAAAGAAGGAT[C/A]AACCACTGCTGATCAGCTCTCCATCTCACTGGAAGAATGCTTGAGCTCCGTTCCGGTGTCTCCCTCTGACACTGAAGCAGCTTTAAATCAAAATTCAAATAAAGGTTCTGGTTATAAATTAGATGAGACTGTTAGGGAGAACAGCCCAGAGAAACAAAAGCCTGAGGATGATGAGACTTTAAATGCGAAATCGCAAGAGAAATTAAGTACGAGCACGGCAGAGATTGTTGATGATAGTTCTAAAGGATGCTCTAGATTTTCTGTGGTACGAACTGTGGAGGAGGCTGTCGTCATACCTGCAGCTGATACCGACAACAGAGGCGAAAGTACAGTACAACAAGATGACCCTAAGACTGAGCAAATTAGTCAGAAGAGTATAGACAGCAGCAAATAATCAGTAAACTAATAGACCATAGATATGATTACAGAATCCCAGCCCCACAAATATTAACGCCGGTCAGACAATCGTGTTTAAAGGAACACTTCACTTCAAAAACTCG
Associated Phenotype:
Not determined