Busch Lab

ZMP

ankha

Ensembl ID:
ENSDARG00000071724
ZFIN ID:
ZDB-GENE-050913-33
Description:
progressive ankylosis-like protein [Source:RefSeq peptide;Acc:NP_001025430]
Human Orthologue:
ANKH
Human Description:
ankylosis, progressive homolog (mouse) [Source:HGNC Symbol;Acc:15492]
Mouse Orthologue:
Ank
Mouse Description:
progressive ankylosis Gene [Source:MGI Symbol;Acc:MGI:3045421]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa37832 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37832
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106260 Nonsense 17 306 1 7
ENSDART00000127568 Nonsense 17 496 1 12
ENSDART00000144688 None None 464 None 11

The following transcripts of ENSDARG00000071724 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 10194650)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 10253534
GRCz11 24 10393920
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATGAAGGACTGTTTATCAGAAACTGCGTACTGGCCCCTTATTCGCTTTT[T/A]GCTGCCACTGGCCATAACTAATATAGCCATCGACTTCGGGGAACAGGTGA
Associated Phenotype:
Not determined