Busch Lab

ZMP

si:dkey-20i20.5

Ensembl ID:
ENSDARG00000071714
ZFIN ID:
ZDB-GENE-060503-812
Description:
hypothetical protein LOC560276 [Source:RefSeq peptide;Acc:NP_001121715]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa25174 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3338
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106237 Nonsense 309 715 3 6
ENSDART00000145463 None None 195 None 2
Genomic Location (Zv9):
Chromosome 22 (position 2076868)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2817958
GRCz11 22 2834224
KASP Assay ID:
554-2960.1 (used for ordering genotyping assays)
KASP Sequence:
TTCACACTGCGACAAGAGATTCAGTTTTTCACAAAACCTGAAGACACACT[T/A]GAGGACTCACACTGGAGAGAAACCGTATCACTGCACTGCTTGTGGGAAGA
Long Flanking Sequence:
CGTAGGTCTTAAACTAAATTCCTGGAGGGCCGCAGCTCTGCACAGTTTTGCTCCCGGTGAGTTGATGACTCTGTGCAAATCTACGACCCTCCAGGAATTGAGTTTGAGACCTATGTTCTAGAGGAACTGTTCAAATCAAACCTCTTAATATTCACTTTCAGATGTGACGGTGAAGGAGGAGAGTGAAGAACTGAATGAAGATGTCAAAAGTGAAGAAAAAACCCAATCAGAGACTGAACATAGTATTTCAGTGAAAGGAACAGCAGTAAATAGTTGGACCTGCACTCAGTGTGGAAAGAGTTTGAGCTGCAAAAGCGCTCTCAATACTCACATGAGGATCCACACTGGAGAGAAACCTTACCAGTGTTCGCACTGCGGCAAGAGATTCAGTAATTCAGCATATCTGAAATCACACAAGAGGATTCACACTGAAGAGAAACCTTACCAGTGTTCACACTGCGACAAGAGATTCAGTTTTTCACAAAACCTGAAGACACACT[T/A]GAGGACTCACACTGGAGAGAAACCGTATCACTGCACTGCTTGTGGGAAGAGTTTCAGACATATGTCTTCTCTACAAACACACACAAGAAACCATCACAGTAAGTAGATCATCTAAAGGTCCAGGTTGCATTATTTAGGATAAAATCTGTCCCAGCAAACCCACAACTAGACAAATGTGCCCAGATGTTAAAGTAGTTCAAGCATCTTAACTCCTAAATATTTACAGTTTGCAGACATGTATTTTAGTCAGTATTGATTGCACTGTCAAGTCTTTCTAAAGAAACTGTTCAGAACTAACCTCTTAAAATGAACTTATTTACCAAATTTTCAGATGTGATGGTGGAGGGGAGCGAAGATAAGGAGAAACATCATGTCACTAGTAAACAAAAAACTTTCAACTGCACTGAGTGTGGAAAGAGTTTTAAGCGCAAATACCATCTGATTTTTCACTTGAAGATCCACAGTGGAGAGAATCCTTACAAGTGTTCACACTGCGACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25174
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106237 Nonsense 671 715 6 6
ENSDART00000145463 None None 195 None 2
Genomic Location (Zv9):
Chromosome 22 (position 2080864)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2821954
GRCz11 22 2838220
KASP Assay ID:
554-7471.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGTATCAGTGCCTCGTGTGTGAAAAGAGCTTTCTTAGACCTGGAGCAT[T/A]GAAACAGCACCTGAAGATTCACACTGGAGAGAGACCACACAAATGTGATC
Long Flanking Sequence:
GCAACTGTTTCAGCTCAGCTGGAGCTTGCTCTCTTAAAATGTAAATGTTTTCTTTGCTTAATTTTTAGACGTGAAGGAGAAGATGGACAACCATAGCATCCACACAACAGAGAAACTACATCTGTGTTCTGAGTGCGGAAAGAGTTTTGCAACACAGTCATATTTAAATGCACATCAGAAGATCCACTTTGGAGAGAAACCATTCACATGCACTCAGTGTGGGAGGAGTTTCAGATATTCATCACAACTGAATGAACACATGATGACCCACACTGGAGAGAAGCCACACGAGTGTGATCAATGCGGAAAAAGATTTTTGAAGGCTTCAAACCTGAAGGTCCATTTTGGAGTTCATACAAAGGAGAAGCCTTATCCGTGTCCTGTGTGTGGAAAAATGTTTGCACGTCCGTCACTTGTAAAAGAACATGAGCAGATCCACATTGGTGTTAAAAAGTATCAGTGCCTCGTGTGTGAAAAGAGCTTTCTTAGACCTGGAGCAT[T/A]GAAACAGCACCTGAAGATTCACACTGGAGAGAGACCACACAAATGTGATCAATGCGGCAGAGCGTTTGTGAGGTCTGCACAACTAAAGTGCCATCTTAAAGTTCATGCAAAGGAGACACAGTCAGTTCTTAGATAGTAAAGAGTTTCACACTTTAATCTACCTTACTGAAAACTCTATTTACCAACATCAGATTTGATAGTCAACTGTTAGTATGTTAATAAACCCCAATCTTTTGTAGGACACACTTTATCACAATTAGTTCGGTTGCGCAATTCTGATTGGGCAGAACGAAAGTGTGCTCACTCAACTGTGTGCCACACAGATGACCGTCACGCATTTGCTCTGGGTGGGGGAAGTTAATTAATATACATTTCATTTTGCAGAATCTTGCGATTAGCTAGTCGCAATGTTTCAAATCACGATTGCGATTCGATTTTGATTAATCGCACAGCCCTAGTCACAACGTATTGACGTCATTTACGATGATGTAATAACTATA
Associated Phenotype:
Not determined