Busch Lab

ZMP

si:ch211-278g15.1

Ensembl ID:
ENSDARG00000071692
ZFIN ID:
ZDB-GENE-091113-37
Human Orthologue:
PREX2
Human Description:
phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2 [Source:HGNC Symbol;Acc:229
Mouse Orthologue:
Prex2
Mouse Description:
phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2 Gene [Source:MGI Symbol;Acc

Alleles

There are 12 alleles of this gene:

Allele Name Consequence Status Availability
sa12110 Nonsense Available for shipment Available now
sa18614 Nonsense Available for shipment Available now
sa13066 Essential Splice Site Available for shipment Available now
sa6763 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa37864 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa24475 Nonsense Available for shipment Available now
sa15890 Nonsense Available for shipment Available now
sa24476 Essential Splice Site Available for shipment Available now
sa24477 Nonsense Available for shipment Available now
sa39442 Nonsense Mutation detected in F1 DNA Not yet available
sa37865 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12110
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106186 Nonsense 17 1600 1 40
ENSDART00000106186 Nonsense 17 1600 1 40
Genomic Location (Zv9):
Chromosome 24 (position 19498296)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 18804450
GRCz11 24 18948869
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATGACTGAGGAGAGCAAAGCCGAACACAGAGCCGAAAGTGGAAAAGATT[T/A]AGASAAGCAGCTTCGTTTGAGAGTTTGTGTTTTGAACGAACTTCTGAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18614
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106186 Nonsense 17 1600 1 40
ENSDART00000106186 Nonsense 17 1600 1 40
Genomic Location (Zv9):
Chromosome 24 (position 19498296)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 18804450
GRCz11 24 18948869
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATGACTGAGGAGAGCAAAGCCGAACACAGAGCCGAAAGTGGAAAAGATT[T/A]AGASAAGCAGCTTCGTTTGAGAGTTTGTGTTTTGAACGAACTTCTGAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13066
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106186 Essential Splice Site 46 1600 1 40
Genomic Location (Zv9):
Chromosome 24 (position 19498385)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 18804539
GRCz11 24 18948958
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AACTTCTGAAGACCGAGCGGGATTATGTTGGGACGCTGGAGTTTCTTTCG[G/A]TAAGGGATTTTTYCTTTTCCTGTTTAGCANTTTTAYATGTACGTTGTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6763
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106186 Essential Splice Site 111 1600 3 40
Genomic Location (Zv9):
Chromosome 24 (position 19541427)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 18847581
GRCz11 24 18992000
KASP Assay ID:
554-4464.1 (used for ordering genotyping assays)
KASP Sequence:
GCCTGACCCAAACCCCTATCATGAAGTGGGCCACTGCTTCCTGCACTTTG[T/C]GAGTCACTGTCTGATACGCTCTCTCTTCACTTACTGTATTACACTCATCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4288
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106186 Essential Splice Site 314 1600 9 40
Genomic Location (Zv9):
Chromosome 24 (position 19569497)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 18875651
GRCz11 24 19020070
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAAGGCGTCTCTGASTGGCAGACATTGATTATTTGTCGTGTTTTTCTTCA[G/A]CTGATTTTCACAGCAGCGGCAACATTGTGAACAACGGCTGGAAGATCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37864
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106186 Essential Splice Site 412 1600 10 40
Genomic Location (Zv9):
Chromosome 24 (position 19572569)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 18878723
GRCz11 24 19023142
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGACCGCAAGCGAAAACTCACCACCTTCCCCAAGTGCTTCCTTGGAAG[G/A]TAGGTCAACAAAAGCTGGACCTCTGTGTGGATAATAGCTGTGGTAGACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24475
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106186 Nonsense 662 1600 18 40
Genomic Location (Zv9):
Chromosome 24 (position 19606202)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 18912356
GRCz11 24 19056775
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCGACCTTTCCAGGAAGTAGAAAACTTTCTAAAGCAGTGCTTCCACAGC[A/T]GAGGTCCCATCAGAGTCCTGGTCAGCACCAAACCCAGAGAGTAAGTGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15890
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106186 Nonsense 824 1600 22 40
Genomic Location (Zv9):
Chromosome 24 (position 19616660)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 18922814
GRCz11 24 19067233
KASP Assay ID:
2261-8622.1 (used for ordering genotyping assays)
KASP Sequence:
AGCCTAACGGTGGATAACGWATATCTGGAGTACGGCGTCATGTATGAATA[C/A]GACAGCACAGCTGGCAYGAAGTGTYACRTCTTGGAGAAAATGGTRGAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24476
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106186 Essential Splice Site 1107 1600 26 40
Genomic Location (Zv9):
Chromosome 24 (position 19640569)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 18946723
GRCz11 24 19091142
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGCAGGAGGACTCAGGTCATGACACCATCAGCAACCGGGACTCCTACAG[G/A]TAAATGTGCATACAGTGACCATACGTTTACTGTTAAATGGGGTGTCTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24477
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106186 Nonsense 1185 1600 29 40
Genomic Location (Zv9):
Chromosome 24 (position 19649678)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 18955832
GRCz11 24 19100251
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTCCATCACTAGTTTGCTAAAAGGGGCAACCGTGACACGAGCTTTTGAA[C/T]AAACTAAATGCTTCACTCCAGGACGAGGACTTCAAGGTACTAAACCTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39442
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106186 Nonsense 1193 1600 29 40
Genomic Location (Zv9):
Chromosome 24 (position 19649702)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 18955856
GRCz11 24 19100275
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGCAACCGTGACACGAGCTTTTGAACAAACTAAATGCTTCACTCCAGGA[C/T]GAGGACTTCAAGGTACTAAACCTACTGACACACATGCACACAAACTAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37865
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106186 Nonsense 1437 1600 35 40
Genomic Location (Zv9):
Chromosome 24 (position 19681149)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 18987303
GRCz11 24 19131722
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGAGGAGTATCAGGCTCAGATCAATGCGGGCTCTCTGGAGAAGGTCAAG[C/T]AGTACTACAAGAGACTCCGGTAAGCCTGATTCAGCTGTCAGTCAAACCTC
Associated Phenotype:
Not determined