Busch Lab

ZMP

wu:fk33d07

Ensembl ID:
ENSDARG00000071652
ZFIN ID:
ZDB-GENE-030131-8898
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0R0L1]
Human Orthologue:
RRP8
Human Description:
ribosomal RNA processing 8, methyltransferase, homolog (yeast) [Source:HGNC Symbol;Acc:29030]
Mouse Orthologue:
Rrp8
Mouse Description:
ribosomal RNA processing 8, methyltransferase, homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:19142

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa14445 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14445
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106112 Nonsense 35 533 2 7
Genomic Location (Zv9):
Chromosome 15 (position 14246872)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 15291835
GRCz11 15 15227857
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTCTNAAAAAATTATGTTTTAATATCCGAACAGAAAAAAGCTGTKGGTAAA[C/T]AAAGCCTTTTGAGAACCTTGCAAACACTGGGTTCAGTTCCAGACTGGGAA
Long Flanking Sequence:
AGTATTGTGCTCACTGTTCTAAAATAAATTATTTTATAATGTCTGGGTAAAAAAAACAAAAACTTTTTTTTTCACCTTTCAAAACAATATATTTAATTTTTTTGAAAGATTTATAATATTTTGGGGCAGTAAACATGTCAGACTATATGATTCAAATGAATCATTGACTTCTGCTGTCTTCACTTGTTTCAAAAACACAGATTTCTTTACAATTTAAACAGCATCTTTTGATATCTTTTTCAGTGAAGATACTGTTGTCCTAAAAAACAAACAAACAAACAAACAAAAAAAGTAAATAAAAATATTACACATACCTTAGGAACGGTATTGCAAAAAATTTTGGCGGTTTTAAAACCTTGACTTTTCCAAACCATTTTTCTTGAAAACTGTTATTGTCCCATGCCTATAATTCACATCCTTTAATTTTTGATATATCCCTGTACATTTTAAGTCTAAAAAATTATGTTTTAATATCCGAACAGAAAAAAGCTGTGGGTAAA[C/T]AAAGCCTTTTGAGAACCTTGCAAACACTGGGTTCAGTTCCAGACTGGGAAGTTGGGAAAGCTGTCGAGGAGGATAGCGACGAGGAGAAAGATGCGTCCGCTGCAGTCAAGAAACCAAAAAAGAAAAGGTGCAAAAAGCGTAAAAGAAAATCTAACGCTGATAATGAAGAGAAGCAGATGGGGGAAGAGGATTCTGAAGCACCAGTAAAGAAGAAAAAGACAACGACAAAACCAGTGAAGAAAACAAAAAGTGAGTGCATATGATGTTTACTTTTTGTCTGCCATCAAGAACATTTCTGACTTTTTCCACACAAATCTGTTTTTGCAGGATCAGTGGTGTCAGAAGAGCCCAAAAAAGATGACAACGCAGTCAGAGCTCAGTTGGAGAAAAACGAAAGTCAGACAGAGAAAAAGCTGAGCAGACAGCAGTGGAAGAACAAGATGAAGAACAAAAGAAAGAGTAAAAACAAATATCTTCAGAAACAAACAAGTGATGATACC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19105
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106112 Nonsense 317 533 3 7
Genomic Location (Zv9):
Chromosome 15 (position 14245947)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 15290910
GRCz11 15 15226932
KASP Assay ID:
2260-8217.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTGAAGGGTGTTGAAGATCAAACGGCTCCTCTTGATCCCTCCACTGCTT[T/A]AAGGTTAAAGATGGAGAAACAGTTAGAAGCTGCTCGCTTTCGCTTCATCA
Long Flanking Sequence:
GCAGTGGAAGAACAAGATGAAGAACAAAAGAAAGAGTAAAAACAAATATCTTCAGAAACAAACAAGTGATGATACCAGTCCAAAGAAGGAAACTTTAGTTCAAACACAGCAAATCAAAGAATTCAAGAACCCCCTGAAACCTGACAGGACATCCAAAAAAACGTCCAAAAAAATTAATAAGATAATTGAAAAGAATGCCTCCTCCATCGGGGACAATGCTGGGACTTGCACAGACTCTAAAACTGATAAAACAATCTTCACAGAAACTATAAAAGTTGACGACTCCCTAAACAACAGCTACAACACTTCACAAGAAATAGGAGAAACCGACAAACATGCAAAAAAGACAAAAAAGTTACAGGCAGAGAAACTGCGTCGTATTTTGAAGTCAAAGTCAAGTCGTACTGATAGTGATAAAGTCACTGAGACCCCAAAAGATGCAGCAGTGGATTTGAAGGGTGTTGAAGATCAAACGGCTCCTCTTGATCCCTCCACTGCTT[T/A]AAGGTTAAAGATGGAGAAACAGTTAGAAGCTGCTCGCTTTCGCTTCATCAATGAGCAGCTTTACACTTCCACCAGCGCTGCGGCCAAACGCATGTTTCAGCAGGATCCAGACGCCATCACCATTTATCATAAGGGGTACACAACACAGGTTCAACACTGGCCCACAAACCCTGTGGATTCCATCATCTCCTATATTTGTCAAAAGTGAGGTTTATAAATGTAGGCAGAGCAAATAATATATTTTGACTGAAAAATAACTAATAGCATGTATAAGAATTTAATTATATAATAGTAATAATACAATTTCTATTAGTTTTATTTTCAGTCAAATTTTTATTATTTGTAATTTGTTGTGTTTGATGTGTGTATATACAGTTGAAGTCAGAATTATTAGCGCCTCAGAATTAGTAGCCCCCCGTTTATTTACGGAGAGATTTTTTTCAACACATTTCTAAATACAACATTTTTAATAACTCATCTCTAATAACTGATTTATTTTA
Associated Phenotype:
Not determined