Busch Lab

ZMP

aqp8a.2

Ensembl ID:
ENSDARG00000071592
ZFIN ID:
ZDB-GENE-070112-1802
Description:
aquaporin 8 [Source:RefSeq peptide;Acc:NP_001073651]
Human Orthologue:
AQP8
Human Description:
aquaporin 8 [Source:HGNC Symbol;Acc:642]
Mouse Orthologue:
Aqp8
Mouse Description:
aquaporin 8 Gene [Source:MGI Symbol;Acc:MGI:1195271]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa15808 Essential Splice Site Available for shipment Available now
sa12944 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15808
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105952 Essential Splice Site 199 257 3 5
Genomic Location (Zv9):
Chromosome 12 (position 21711810)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 20237443
GRCz11 12 20359317
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGTGCCCTTCATGGTGGGCTGCACCGTTATTGTCAATATTCTAGCAGGG[T/C]GAGTCTGGAAAYRGTCTAAATWAATGGTGAAAAGTTTAAAAAAGGCAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12944
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105952 Essential Splice Site 244 257 4 5
Genomic Location (Zv9):
Chromosome 12 (position 21708324)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 20233957
GRCz11 12 20355831
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TATTGGGTCGGTCCGTTGGGAGGTGGTCTGRTGGCTGCCGCTCTTATGAG[G/A]TCAGTGTGCTTTCATTTAAAATATTWCATTGTTTCTTGCTCAAGTTTTKT
Associated Phenotype:
Not determined