Busch Lab

ZMP

si:dkeyp-87e7.4

Ensembl ID:
ENSDARG00000071570
ZFIN ID:
ZDB-GENE-030131-6208
Description:
hypothetical protein LOC557283 [Source:RefSeq peptide;Acc:NP_001038175]
Human Orthologue:
CCDC71
Human Description:
coiled-coil domain containing 71 [Source:HGNC Symbol;Acc:25760]
Mouse Orthologue:
Ccdc71
Mouse Description:
coiled-coil domain containing 71 Gene [Source:MGI Symbol;Acc:MGI:1919704]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa31068 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa43773 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa37437 Nonsense Mutation detected in F1 DNA Not yet available
sa17837 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31068
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105900 Essential Splice Site None 264 None 3
ENSDART00000139297 Essential Splice Site None 345 None 2
ENSDART00000105900 Essential Splice Site None 264 None 3
ENSDART00000139297 Essential Splice Site None 345 None 2
Genomic Location (Zv9):
Chromosome 22 (position 10342776)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10202944
GRCz11 22 10232626
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGCTCGTCGGCTCTCATTTCAATGCTCTCAGAAGGGACTCGGTAAAAGG[T/C]AAGACACATTGTTTAAATATTATCTATTTACTTGCAGGAGGGAGCGTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43773
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105900 Essential Splice Site None 264 None 3
ENSDART00000139297 Essential Splice Site None 345 None 2
ENSDART00000105900 Essential Splice Site None 264 None 3
ENSDART00000139297 Essential Splice Site None 345 None 2
Genomic Location (Zv9):
Chromosome 22 (position 10342776)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10202944
GRCz11 22 10232626
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGCTCGTCGGCTCTCATTTCAATGCTCTCAGAAGGGACTCGGTAAAAGG[T/C]AAGACACATTGTTTAAATATTATCTATTTACTTGCAGGAGGGAGCGTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37437
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105900 Nonsense 72 264 2 3
ENSDART00000139297 Nonsense 72 345 2 2
Genomic Location (Zv9):
Chromosome 22 (position 10370282)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10230450
GRCz11 22 10260132
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGAGGGAGCGAAACCTGTGATCCTGCGGAGCAAAGATGTGTACGGATA[C/A]ACATCTTGCACTACGGAGCCAATTTCCTCCAGGATTAGCACTACCAAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17837
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105900 None None 264 3 3
ENSDART00000139297 Nonsense 329 345 2 2
Genomic Location (Zv9):
Chromosome 22 (position 10371051)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10231219
GRCz11 22 10260901
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGATTCAGTCACAGATGAGGAGTTGAGGAGGAAGGCACAGAAAATCTTG[C/T]AAGTGAACTTGTCGCCTGTGATACAGATYCATCCCCTTGTTGACTCTGTA
Associated Phenotype:
Not determined