Busch Lab

ZMP

ENSDARG00000071547

Ensembl ID:
ENSDARG00000071547
Human Orthologues:
SESN1, SESN2, SESN3
Human Descriptions:
sestrin 1 [Source:HGNC Symbol;Acc:21595]
sestrin 2 [Source:HGNC Symbol;Acc:20746]
sestrin 3 [Source:HGNC Symbol;Acc:23060]
Mouse Orthologues:
Sesn1, Sesn2, Sesn3
Mouse Descriptions:
sestrin 1 Gene [Source:MGI Symbol;Acc:MGI:2155278]
sestrin 2 Gene [Source:MGI Symbol;Acc:MGI:2651874]
sestrin 3 Gene [Source:MGI Symbol;Acc:MGI:1922997]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa35710 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28325
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105853 Nonsense 95 444 3 8
Genomic Location (Zv9):
Chromosome 14 (position 31799705)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 30589613
GRCz11 14 30929927
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGTAACGTTTGTTATTGTGCTTGTTTCAGGCTGCAGCGCGGCATCACTG[T/A]AGGTACCTGGTTTCTCTGCATTCAGCTCAGTTTCTGCGTGTTGGCGGAGA
Long Flanking Sequence:
GTCTTTTTTTTGCCTGAATGCTTTAAACTCTTTTAAAATGTCTTAAACACATGCAAAGGATAATGTTTCACTTGGTTTTGTGACTACACAAATCTCTGAATATCTGAATTTCTGTGCTGATCAACTATAATAATGCAAAACTCAACATTGCTTATTCTGCGATGTGACTATTGCAGACGTACATGTTGTGATATTGATGCTGAAATGATATGTTGTGCAGTTCTACCTTTAAACTATTTAATAATATATATTTTTATGTAAAATTAATAAACCTATGAAAATTGATGAAATTGTCAAATTGGTATCATCAAACATCAAATGTTGACTCGTTTTCCCATTTATTCATTAATGTTCTGTACTGCTCTTAAAAAGTCAAACATTTACCTTCATAAAACTTGCTGAACCGCTGACATCTTGCACAGATTTCTACAAATCTTCAAACCCGATATAAGGTAACGTTTGTTATTGTGCTTGTTTCAGGCTGCAGCGCGGCATCACTG[T/A]AGGTACCTGGTTTCTCTGCATTCAGCTCAGTTTCTGCGTGTTGGCGGAGACCCGCTGTGGCTTCAGGGCCTGGAGGCGGCACCAGCTCGACTACGGCACCTCGATCATATCAACAAGGTTCTGGCCCATCAGCCCTGGCTCACCGCTCGCTCACACATACAGGCTTTACTGAAGACAGGAGAGCAGTGCTGGTCTCTGGCTGAGCTGGTGCAGGCTGTGGTTCTGCTGGCCCACTGTCACTCCCTTTGCAGTTTCGTTTTTGGTTCCGGTTCTGATTCGGACATCACTACCACTCCCAGAGTGCATCACGGCACACCCCCTGGATGCTGCCTCTGTGATGCTGCCAATGGCAACACAGCTCTATCACCACCTTCTTCTGGACCCATGGAGAAGATGCTACGGAGAAGGGTACAGATGATCATTCACAACAGTTTCAATGATGGGTGTTCTGAGAAGTTGCAAAGTTTAGCTGCGCATTACTGTCACACATTGCTCTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35710
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105853 Nonsense 260 444 4 8
Genomic Location (Zv9):
Chromosome 14 (position 31797731)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 30587639
GRCz11 14 30927953
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGAACAAATTCATAAATCACAGGATGAAATCAAGGAAAGAAAGGGGGAC[C/T]GACTCCATTCACAGACGCTCCTACATTCAGGTAAGATGTTCACCCATGTA
Long Flanking Sequence:
AAAACAAGCTCGCCACCCTATCTCCCCCTCCCACCCTATAAGATCTGTTGACTTTTAATTGTCCCAATAACTAAAGATTAGTAGTGCCAACACGCTGTCCCACCCCACTCTCCCCCTAACTTCATACCCCTGGGATATGAATTTTTACAGGCTTGAATGTAAATTTTTAGATAAAACTAAATGAAATATTCAAAAAGTGTAAATACAACACCTAAATAATACTGAATAAGAAAGCATTTAAGTTTAGGGATAGGTGTTAGGGTACCCTAGTATTGGCGTCCATTTCATAATACATATCTGTCATTATTTCCACAAAGTAAATCCACTTATTTCGAATAAAAAAACACCACTTATACTGTGAATTGAATAATTAATATTTCCAAAACGTTTGTTTTTAATGCTGGGTTGATTTTTAGTCCCTAGACTCCAGTTGTGATGTTGGTTGCCTTCGAGAACAAATTCATAAATCACAGGATGAAATCAAGGAAAGAAAGGGGGAC[C/T]GACTCCATTCACAGACGCTCCTACATTCAGGTAAGATGTTCACCCATGTAATGCCAGTGTTTTTGGATTTGTGCTCTATTCTTTGCTGTTGTTTTGACATGAATAATATATTGATTTCAATAGAAGATTGTGCCCTTTGAAAACCTGGATGCCACTTATTCAAGTGTGTAATGTTGGACACTATGCACTCAACTGTGGCGGATTTAATTACATAGTGGAGGAGGCAGAGCTTTCAGACTCCAATTTTGATGGACAAACTAACCTTATAAAGTTCATTCACTAGACTGTTGAGTATGTAGTGCGTCATTTGGGAGTTGGAACACAACTCGAGTTTCCCAATGCTCCTGTAAACAGGATGTGTAATTTTGGATTGGGGTGAATGTTTATTTTTACACAAGCATCTTTTCTTGTGCATGCATCTCTCCCACATGGACCCCCTTTCGTAACCTGCCTTTCTCTTTCTCAAATGCACCTCCATATCAGATGTGGAGGAGGAGGAG
Associated Phenotype:
Not determined