Busch Lab

ZMP

insrb

Ensembl ID:
ENSDARG00000071524
ZFIN ID:
ZDB-GENE-020503-4
Description:
insulin receptor b [Source:RefSeq peptide;Acc:NP_001116701]
Human Orthologue:
INSR
Human Description:
insulin receptor [Source:HGNC Symbol;Acc:6091]
Mouse Orthologue:
Insr
Mouse Description:
insulin receptor Gene [Source:MGI Symbol;Acc:MGI:96575]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa16909 Nonsense Available for shipment Available now
sa6697 Nonsense Mutation detected in F1 DNA Not yet available
sa32383 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16909
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105823 Nonsense 310 1348 3 21
Genomic Location (Zv9):
Chromosome 22 (position 11063496)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10923664
GRCz11 22 10953346
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCATACGTCATCCACAAYGGGGCCTGCATCCCAGAATGCCCRTCCGGATA[C/A]ACCACCGTCAACTCCACCTCGTACGTATCAATTTTCTCCTCAACAAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6697
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105823 Nonsense 481 1348 7 21
Genomic Location (Zv9):
Chromosome 22 (position 11049510)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10909678
GRCz11 22 10939360
KASP Assay ID:
554-4884.1 (used for ordering genotyping assays)
KASP Sequence:
TTAATTKTTTAGCMRTAAAGTAGACCCGATCTKCATTCTGTCCTRCAGGT[G/T]AAAGTCACATACTCAAATTTACACAAATCCGCACCATGAGCGACAAGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32383
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105823 Nonsense 858 1348 12 21
Genomic Location (Zv9):
Chromosome 22 (position 11041591)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10901759
GRCz11 22 10931441
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACATCAGATGGAAAGAGCCCAAAACTCCTAACGGCATGATCATACTGTA[T/A]GAAGTCAAGTATCTACGGATGTCTGATAACTACGTAAGTGTTATAAATTA
Associated Phenotype:
Not determined