Busch Lab

ZMP

mgat5

Ensembl ID:
ENSDARG00000071506
ZFIN ID:
ZDB-GENE-060616-238
Description:
alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase A [Source:RefSeq peptide;Acc:
Human Orthologue:
MGAT5
Human Description:
mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase [Source:HGNC Symbol;Acc
Mouse Orthologue:
Mgat5
Mouse Description:
mannoside acetylglucosaminyltransferase 5 Gene [Source:MGI Symbol;Acc:MGI:894701]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa13731 Nonsense Available for shipment Available now
sa24101 Essential Splice Site Available for shipment Available now
sa43790 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available
sa45756 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa17972 Essential Splice Site Available for shipment Available now
sa10529 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13731
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105788 Nonsense 47 742 2 17
Genomic Location (Zv9):
Chromosome 22 (position 12105976)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 11966144
GRCz11 22 11995826
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCAKTTCACCATCCAGCAGAGGGCGACGCATGAAAGCAGCGYGCAGCTA[C/T]GAAWGCAGAYACTGGACCTTAGCAAGCGAWACATTAAAGCCCTTGCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24101
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105788 Essential Splice Site 270 742 7 17
Genomic Location (Zv9):
Chromosome 22 (position 12160256)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12020424
GRCz11 22 12050106
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCGCTCACTTGCCAACAAACAAAACCTCCACCACCGCAAACGCAAGAAG[G/A]TGAGGCTAAACATAAAACTGTGTAAAAAAAAAATCATCATCTATGGTAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19281
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105788 Splice Site, Nonsense 371 742 9 17
ENSDART00000105788 Splice Site, Nonsense 371 742 9 17
ENSDART00000105788 Splice Site, Nonsense 371 742 9 17
Genomic Location (Zv9):
Chromosome 22 (position 12165244)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12025412
GRCz11 22 12055094
KASP Assay ID:
2261-6518.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGGGCCTGGCGCAGTTCAAGAAGACCCTCGGCCCGTCCTGGGTCCATTA[T/G]CAGTAAGTGCAGAAATGTTTTAGTTATGAGCCCGCGGATGTGAGCGGACT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7979
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105788 Splice Site, Nonsense 371 742 9 17
ENSDART00000105788 Splice Site, Nonsense 371 742 9 17
ENSDART00000105788 Splice Site, Nonsense 371 742 9 17
Genomic Location (Zv9):
Chromosome 22 (position 12165244)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12025412
GRCz11 22 12055094
KASP Assay ID:
2261-6518.1 (used for ordering genotyping assays)
KASP Sequence:
GTGGGCCTGGCGCAGTTCAAGAAGACCCTCGGCCCRTCCTGGGTCCATTA[T/A]CAGTAAGTGCAGAAATGTTTTAGTTATGAGCCCGCGGATGTGAGCGGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43790
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105788 Splice Site, Nonsense 371 742 9 17
ENSDART00000105788 Splice Site, Nonsense 371 742 9 17
ENSDART00000105788 Splice Site, Nonsense 371 742 9 17
Genomic Location (Zv9):
Chromosome 22 (position 12165244)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12025412
GRCz11 22 12055094
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGGGCCTGGCGCAGTTCAAGAAGACCCTCGGCCCGTCCTGGGTCCATTA[T/G]CAGTAAGTGCAGAAATGTTTTAGTTATGAGCCCGCGGATGTGAGCGGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45756
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105788 Essential Splice Site 372 742 9 17
Genomic Location (Zv9):
Chromosome 22 (position 12165248)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12025416
GRCz11 22 12055098
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCTGGCGCAGTTCAAGAAGACCCTCGGCCCGTCCTGGGTCCATTATCAG[T/G]AAGTGCAGAAATGTTTTAGTTATGAGCCCGCGGATGTGAGCGGACTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17972
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105788 Essential Splice Site 372 742 10 17
Genomic Location (Zv9):
Chromosome 22 (position 12167875)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12028043
GRCz11 22 12057725
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGCCATATTTCTCGTCCTCATCTGGTGTTGTCGGCCTCTGTTGCGTTTT[A/C]GGTGWATGCTGCGTGTGCTGGACTCATTCGGGACGGAGCCRGAGTTCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10529
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105788 Nonsense 373 742 10 17
Genomic Location (Zv9):
Chromosome 22 (position 12167880)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12028048
GRCz11 22 12057730
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATATTTCTCGTCCTCATCTGGTGTTGTCGGCCTCTGTTGCGTTTTAGGTG[T/A]ATGCTGCGTGTGCTGGACTCATTCGGGACGGAGCCRGAGTTCAATCACGC
Associated Phenotype:
Not determined