Busch Lab

ZMP

si:dkey-121a11.10

Ensembl ID:
ENSDARG00000071462
ZFIN ID:
ZDB-GENE-050208-475
Description:
Novel protein similar to vertebrate laminin, alpha 3 (LAMA3) [Source:UniProtKB/TrEMBL;Acc:Q1LXE7]
Human Orthologue:
LAMA3
Human Description:
laminin, alpha 3 [Source:HGNC Symbol;Acc:6483]
Mouse Orthologue:
Lama3
Mouse Description:
laminin, alpha 3 Gene [Source:MGI Symbol;Acc:MGI:99909]

Alleles

There are 15 alleles of this gene:

Allele Name Consequence Status Availability
sa31071 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available
sa43803 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available
sa7492 Missense Mutation detected in F1 DNA Not yet available
sa24130 Essential Splice Site Available for shipment Available now
sa43802 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa37479 Nonsense Mutation detected in F1 DNA Not yet available
sa5969 Nonsense Mutation detected in F1 DNA Not yet available
sa11864 Nonsense Available for shipment Available now
sa37478 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa15223 Nonsense Available for shipment Available now
sa37477 Nonsense Mutation detected in F1 DNA Not yet available
sa37476 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa24129 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa37475 Essential Splice Site, Missense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa31071
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062705 Nonsense 41 1657 1 41
ENSDART00000126827 Nonsense 46 1681 1 41
ENSDART00000130840 Nonsense 60 1028 2 27
ENSDART00000135987 Splice Site None 1263 None 29
ENSDART00000062705 Nonsense 41 1657 1 41
ENSDART00000126827 Nonsense 46 1681 1 41
ENSDART00000130840 Nonsense 60 1028 2 27
ENSDART00000135987 Splice Site None 1263 None 29
Genomic Location (Zv9):
Chromosome 22 (position 16622344)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16374102
GRCz11 22 16400372
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAACTGCAATGGCCTGTCCGGTGACTGCGACCCACATACTGGGAAATGTT[T/A]GGTATTATGTGTTGTTTATTATCAGTTTGAGAAAGTTAGCCCTCATCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43803
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062705 Nonsense 41 1657 1 41
ENSDART00000126827 Nonsense 46 1681 1 41
ENSDART00000130840 Nonsense 60 1028 2 27
ENSDART00000135987 Splice Site None 1263 None 29
ENSDART00000062705 Nonsense 41 1657 1 41
ENSDART00000126827 Nonsense 46 1681 1 41
ENSDART00000130840 Nonsense 60 1028 2 27
ENSDART00000135987 Splice Site None 1263 None 29
Genomic Location (Zv9):
Chromosome 22 (position 16622344)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16374102
GRCz11 22 16400372
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAACTGCAATGGCCTGTCCGGTGACTGCGACCCACATACTGGGAAATGTT[T/A]GGTATTATGTGTTGTTTATTATCAGTTTGAGAAAGTTAGCCCTCATCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7492
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062705 Missense 147 1657 6 41
ENSDART00000126827 Missense 152 1681 6 41
ENSDART00000130840 Missense 166 1028 7 27
ENSDART00000135987 None None 1263 None 29
Genomic Location (Zv9):
Chromosome 22 (position 16620029)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16371787
GRCz11 22 16398057
KASP Assay ID:
554-4190.1 (used for ordering genotyping assays)
KASP Sequence:
ATANNNGTAGTAATGATATTAATGAAWCCATTTGTTTGTCTTTATAGATT[G/T]TTATGAGGCTGATGACCCAGACACCGACAACTGCTTTRRTTKGTCATAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24130
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062705 Essential Splice Site 160 1657 6 41
ENSDART00000126827 Essential Splice Site 165 1681 6 41
ENSDART00000130840 Essential Splice Site 179 1028 7 27
ENSDART00000135987 None None 1263 None 29
Genomic Location (Zv9):
Chromosome 22 (position 16619989)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16371747
GRCz11 22 16398017
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTATAGATTGTTATGAGGCTGATGACCCAGACACCGACAACTGCTTTGG[T/C]TTGTCATAACAGAAAAAAAACATGAATGTATGTATGGATGAACATTACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43802
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062705 Essential Splice Site 248 1657 9 41
ENSDART00000126827 None None 1681 None 41
ENSDART00000130840 Essential Splice Site 267 1028 10 27
ENSDART00000135987 Essential Splice Site 218 1263 7 29
Genomic Location (Zv9):
Chromosome 22 (position 16619474)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16371232
GRCz11 22 16397502
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATCTTTATGTTGGCTGTAAAATAGATTTCAACTTGTGTTTCCTTTCTTC[A/C]GGCTATTGAGATGTCCTGTTCTGCAGTTCAGTTGCTCAAGTCTATTGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37479
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062705 Nonsense 594 1657 16 41
ENSDART00000126827 Nonsense 602 1681 17 41
ENSDART00000130840 Nonsense 617 1028 18 27
ENSDART00000135987 Nonsense 564 1263 14 29
Genomic Location (Zv9):
Chromosome 22 (position 16616530)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16368288
GRCz11 22 16394558
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGCACAGAAATGCGAAGCATACAAGAACCTGATCCAACAGGCTGAAGAC[A/T]AACAGAAGCAACTCAAGCAAGTCATGCTGGATGTGTTGGAGAAGATGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5969
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062705 Nonsense 677 1657 18 41
ENSDART00000126827 Nonsense 685 1681 19 41
ENSDART00000130840 Nonsense 700 1028 20 27
ENSDART00000135987 Nonsense 647 1263 16 29
Genomic Location (Zv9):
Chromosome 22 (position 16615236)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16366994
GRCz11 22 16393264
KASP Assay ID:
554-3947.1 (used for ordering genotyping assays)
KASP Sequence:
CTGAATGTTATATATGGTTTCTTTTCTTTCATKCAGTRACAGAACTTGAT[C/T]AAACTTTCCCTTCGTTGATTGACAAACTGAATGATGTGGAGAACCAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11864
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062705 Nonsense 836 1657 20 41
ENSDART00000126827 Nonsense 844 1681 21 41
ENSDART00000130840 Nonsense 859 1028 22 27
ENSDART00000135987 Nonsense 806 1263 18 29
Genomic Location (Zv9):
Chromosome 22 (position 16612848)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16364606
GRCz11 22 16390876
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCACCAAGTCCAGCAATGATAAAGCCTTTATGGATAGGGTGGMTTTCCGC[A/T]GGTAAACAACGTYTTAGTCATTGTAGATCCCCTGTTCTGTCGATTTGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37478
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062705 Essential Splice Site 836 1657 20 41
ENSDART00000126827 Essential Splice Site 844 1681 21 41
ENSDART00000130840 Essential Splice Site 859 1028 22 27
ENSDART00000135987 Essential Splice Site 806 1263 18 29
Genomic Location (Zv9):
Chromosome 22 (position 16612846)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16364604
GRCz11 22 16390874
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCAAGTCCAGCAATGATAAAGCCTTTATGGATAGGGTGGATTTCCGCAG[G/A]TAAACAACGTCTTAGTCATTGTAGATCCCCTGTTCTGTCGATTTGTCCTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29750
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062705 Nonsense 1093 1657 26 41
ENSDART00000126827 Nonsense 1112 1681 27 41
ENSDART00000130840 None None 1028 None 27
ENSDART00000135987 None None 1263 None 29
Genomic Location (Zv9):
Chromosome 22 (position 16611180)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16362938
GRCz11 22 16389208
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTACTTTTACAGAGGAAAACGGAATCGTCCGAGGTTGTCCAAATCCTT[T/A]ACTGGTAGGAATTCTGTGGATTTTCTGACAACATGCATGGATGACAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15223
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062705 Nonsense 1434 1657 35 41
ENSDART00000126827 Nonsense 1457 1681 36 41
ENSDART00000130840 None None 1028 None 27
ENSDART00000135987 None None 1263 None 29
Genomic Location (Zv9):
Chromosome 22 (position 16607293)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16359050
GRCz11 22 16385320
KASP Assay ID:
2261-6652.1 (used for ordering genotyping assays)
KASP Sequence:
AGCCGTTGAAAGGATTCACGCAGGAWTTGCAGTCTCCTGTCTATRTGGGA[C/T]AACTTCAGACTCGTCACCAAACATATGTATGAATGYTTAACGCCCTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37477
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062705 Nonsense 1530 1657 37 41
ENSDART00000126827 Nonsense 1553 1681 38 41
ENSDART00000130840 None None 1028 None 27
ENSDART00000135987 Nonsense 1138 1263 26 29
Genomic Location (Zv9):
Chromosome 22 (position 16606842)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16358599
GRCz11 22 16384869
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCCAAGAAACCTCACCGGCCTCATCTTCCACAAAAGAGACAACCTTGGA[C/T]AGACTGTCACACTATTTCTCAAGAAAGGAAAGGTGAGTGAAAATATGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37476
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062705 Essential Splice Site 1610 1657 39 41
ENSDART00000126827 Essential Splice Site 1633 1681 40 41
ENSDART00000130840 None None 1028 None 27
ENSDART00000135987 Essential Splice Site 1218 1263 28 29
Genomic Location (Zv9):
Chromosome 22 (position 16606048)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16357805
GRCz11 22 16384075
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAGCTCGTCTTTCAGTTCATGAAGAAATCTATATTGGTGGGCTTTCAGG[T/G]AAATCACCTAATGATTTAGTTAAAATATGAGCTGTAATAGTACACTTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24129
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062705 None None 1657 None 41
ENSDART00000126827 Essential Splice Site 1633 1681 41 41
ENSDART00000130840 None None 1028 None 27
ENSDART00000135987 None None 1263 None 29
Genomic Location (Zv9):
Chromosome 22 (position 16605348)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16357103
GRCz11 22 16383373
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACCACACTCCTTGAGTAAATAATTAATTACTGTACATTTCTTGTTTTTT[G/A]TTAATGCAGAGAATCGGAGTGAAGGAGTCGAGATGCAGACCTCTTATGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37475
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site, Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062705 Essential Splice Site 1626 1657 None 41
ENSDART00000126827 Missense 1649 1681 41 41
ENSDART00000130840 None None 1028 None 27
ENSDART00000135987 Missense 1231 1263 29 29
Genomic Location (Zv9):
Chromosome 22 (position 16605299)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16357054
GRCz11 22 16383324
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTAATGCAGAGAATCGGAGTGAAGGAGTCGAGATGCAGACCTCTTATG[A/G]GGGATGTTTGCGGAACATAAGGATTCATCAAAATCCTCTCTCATTTGATA
Associated Phenotype:
Not determined