Busch Lab

ZMP

si:ch211-234p6.7

Ensembl ID:
ENSDARG00000071456
ZFIN IDs:
ZDB-GENE-060503-787, ZDB-GENE-070822-13
Description:
hypothetical protein LOC100124600 [Source:RefSeq peptide;Acc:NP_001096097]
Human Orthologues:
APCS, CRP
Human Descriptions:
C-reactive protein, pentraxin-related [Source:HGNC Symbol;Acc:2367]
amyloid P component, serum [Source:HGNC Symbol;Acc:584]
Mouse Orthologues:
1810030J14Rik, Apcs, Crp, Gm11062
Mouse Descriptions:
C-reactive protein, pentraxin-related Gene [Source:MGI Symbol;Acc:MGI:88512]
RIKEN cDNA 1810030J14 gene Gene [Source:MGI Symbol;Acc:MGI:1913539]
predicted gene 11062 Gene [Source:MGI Symbol;Acc:MGI:3779286]
serum amyloid P-component Gene [Source:MGI Symbol;Acc:MGI:98229]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa6780
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109975 Nonsense 35 225 4 4
Genomic Location (Zv9):
Chromosome 24 (position 39641094)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 38250183
GRCz11 24 38138080
KASP Assay ID:
554-4539.1 (used for ordering genotyping assays)
KASP Sequence:
GGTCTTGGTGGAAAAGTTCTTCTGTTTCCAAYCSAAASTGCTACCAGCTA[T/A]GTTAAACTGACTCCTGATAAACYCCTGARTCTGTCAGCRTTTACTCTCTG
Long Flanking Sequence:
ATGTATTAAAATATCTGTTAGGTGTTTAACACTTGGATCCGCCTATTCTGCCTATAAATAATAGACAGACATCAGGCTAAGAGCATCTTGGAGACTAACAAGTGATCATCTGTCTGACAACAGTTGTTGAACATTAAATTTGGTAAATATTATTTACAGTATTGTGAAGACTTTGTGTATTAGTCTCTGAAAACTGTTTGTTATAAGCAGATGTCTTTAAAGCTGAAAGTTAAAGCAGTGAAGAATGTTTTCTATGGGTATTTTTGCATTATTTTCTTTCAGACCTGCAGCAAAAGATGTTGGGCTTTATTTTCACTCTGCTCATTCTGACACCAGCAGCTGCTGAAGGTAAAACTCTTAAATCAACAGAGCACACAGTTAGCTTTAATGCAGAATTTAGCTTGTTTGCTTCATTATTTTTAATGCATATTTTAATTTTCTCTCACAGTGGGTCTTGGTGGAAAAGTTCTTCTGTTTCCAACCCAAAGTGCTACCAGCTA[T/A]GTTAAACTGACTCCTGATAAACTCCTGAGTCTGTCAGCGTTTACTCTCTGCATGCGTGTGGCGACCGAGCTCCAGGGCGGGCGGGAAGTCATTCTGTTCGCCTACCGCACTTCTGAAGTTGATGAACTCAATGTGTGGAGAGAGAACGATGGCCGTTTGTCCATGTATATTCAGTCTAGTAGCGATGCAGCACGTTTCTATCTTCCCCCTCTCTCCACATTTCAGACACATCTGTGTGTGTCCTGGGAGTCTGCAACTGGTCTTACTGCTTTTTGGGTGGACGGGCGTCGCAGTTTGTACCAGATCTATAAGAAAGACGCCTCTGTCAGACCTGGCGGCACCGTACTGCTCGGACAGGACCCTGATTCATATGTAGGTTCGTTTGACGCAAATCAGTGCTTTATTGGTGAAATTACAGATGTGAAACTGTGGGATTATGTTCTGTCTGAGATCCAGATTAAGGCTTTGTATTCAAACCAGGATCCGTTGGTGCCAGCGGG
Associated Phenotype:
Not determined