Busch Lab

ZMP

si:dkey-161j23.8

Ensembl ID:
ENSDARG00000071449
ZFIN ID:
ZDB-GENE-091204-17
Human Orthologue:
ITFG3
Human Description:
integrin alpha FG-GAP repeat containing 3 [Source:HGNC Symbol;Acc:14163]
Mouse Orthologue:
Itfg3
Mouse Description:
integrin alpha FG-GAP repeat containing 3 Gene [Source:MGI Symbol;Acc:MGI:2146854]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa24560 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24560
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105646 Nonsense 61 546 1 11
ENSDART00000142522 Nonsense 81 504 2 12

The following transcripts of ENSDARG00000071449 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 41206002)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39745196
GRCz11 24 39633043
KASP Assay ID:
2261-9093.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCGTTCCTGCTCTCCATCTTCCTGTGTCTGGCAGTCATCTTCGCCTTTT[C/A]ATTCATCCTCCCCTGCCCCGTACGGCCTCAATATGTGTCCACATGGAACC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30150
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105646 Nonsense 546 546 11 11
ENSDART00000142522 None None 504 12 12

The following transcripts of ENSDARG00000071449 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 41193455)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39732649
GRCz11 24 39620496
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGAGGACTCCGTGAGGGAAGCGTTTCACAGGCTGCGCTTCAGTGAAATA[C/T]AGTGATAAACACACACACACACACACACACACACACACACACACACAGAG
Associated Phenotype:
Not determined