Busch Lab

ZMP

A8E7R8_DANRE

Ensembl ID:
ENSDARG00000071448
Description:
Novel protein similar to vertebrate leprecan-like 1 (LEPREL1) [Source:UniProtKB/TrEMBL;Acc:A8E7R8]
Human Orthologue:
LEPREL1
Human Description:
leprecan-like 1 [Source:HGNC Symbol;Acc:19317]
Mouse Orthologue:
Leprel1
Mouse Description:
leprecan-like 1 Gene [Source:MGI Symbol;Acc:MGI:2146663]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa44988 Nonsense Mutation detected in F1 DNA Not yet available
sa43842 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa44988
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089827 Nonsense 202 678 3 15
Genomic Location (Zv9):
Chromosome 22 (position 23358269)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24423587
GRCz11 22 24450151
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCAGAGAGCCTTCTTCGCTGGCGTGAAGCTCTATGACAAAGGCCACTA[T/A]GAAGAGTCGGTGTCGCTGTTTGAGAAGGCTTTGAGCGAGTATTATCATGC
Long Flanking Sequence:
TTCACTATTTGCTAATGCTAATAGATGATTCGTAGTGTCTAGTTATTATAAACTGTTACCCAGTATTGCTCTCATGGTTCTTATAGCATGTCTTATAGTCATTATTTTTTTATATCTTGCTAATATTAGATGTAAAACATTTAGTTTGCAATAAAACAACCATGTTTGGATTTTATTATCATACTGGTGAAATATGAAAGCTGTGTGTCAAAAAAGAAAAAGCACAATATTGTGGAAATTGGATTTTAAATGCACTACAAATAATTCTTACTTAAAAAAATGTTCTCCAAAATGATTGTATATTAAAAATAACAACTTCACCATTCAAAATGGTTAAATAATCTCAATTGCCAGACTTTCCATGCATTACTACTAATTAGCTCCTCAAACCTTTAAAGACCCCACATTAAACTCTAAAATCACCAGATTTATTTTCATGCATCTTTATATTTTCAGAGAGCCTTCTTCGCTGGCGTGAAGCTCTATGACAAAGGCCACTA[T/A]GAAGAGTCGGTGTCGCTGTTTGAGAAGGCTTTGAGCGAGTATTATCATGCTGATGAGGATTGTCGGGCCCTTTGTGAAGGACCGCAGCACTTCGAGGAGCAGGATCACGTCTTGTACAAATACAGCCTGTACGAGCTCATCTCAGGTACAGATTTTGTATTCCGAGCTTTTCTGCTTGCTTTTAATGTGGTAAAGTGATCATATGCACTTTTGAGAAGGCCCTGGGAGTTTTCCATTGAGCTTCTCATGTTTCTAAAGCTATTTGTGTTTCCATCTTCCCGCTCTGACCTTTATATGAGCCTTGTTTGAGCAAGCAAGAGGCACAAATGTCTGACCTTCTTTTTTTTTTTTTTTGATGTACAGTTGTACAATTTGTTATTGTTGTGTCTGACAGGCAGTTCAGCAACGAACAGCTTGAAAGAGCATGACATACGATTGCCCTACACAAAGTTTTGCATATAAAACAAATCCAGGTGCATCCAAAGGACACTGCTTTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43842
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089827 Essential Splice Site 337 678 5 15
Genomic Location (Zv9):
Chromosome 22 (position 23348184)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24433672
GRCz11 22 24460236
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGGAGTTTTACAGAGAGGTGCTAGGACATGATGGCCAGCCACGTAAGG[T/C]GAGAAACATGGAAGGAGTCACCCAAAACCAAATGATTTCTCATGAATGTG
Long Flanking Sequence:
TCTTTAAAATAGGGTCTTTTGAGTTCATCCGATGAAAGAAACTGATTTGAAAAGACTTAAGATTGAGTAAAAATGGTGAGAAAATGTTTTACAGACGGTAATTCTTTATAAAGTGTCAGTTCATTTAGGTGTGTGTGAATGTTCATGTCTCACTTTTGTGTCTTTCCACTCGCTCAGCTCTGTGGTGTTTCTTCCATTGTGGTCACTGGCCTGGAATGTGAATGTTTCTGAGCGTTTAGGAAATAAACGTGACTCAAAAAAAAAAAAAAAATCACATGATGAATAATCTCCCAGATGAGCCGGAAAAACAGAGCCCTGGTGGCCTCATTAATGCTTAAAAACCTTTTTTTTTCTCTCTCTTTTGTGTTCAGCTGGGAGGTATGAAGAGGCATTGGACTGCGCATTGACTTATCTGTTGTTTCACGAAGGCGAAGAGTTCATGACGGAGAATGTGGAGTTTTACAGAGAGGTGCTAGGACATGATGGCCAGCCACGTAAGG[T/C]GAGAAACATGGAAGGAGTCACCCAAAACCAAATGATTTCTCATGAATGTGTGTGAAGGTTTTAATTTTAATTAAATTCATCTTAATTTCTATAGCTGTTTTACAATGTAGATTTTCAAAGCAGCTTAAGGTAGAAGTTATAGTAAATTGAAACTGTTCAGTTTAGTTCAGTGTGGTTTAATTTTCACTGCTGAAAGTACAAACACTGAAGAGCAAATCCATCAATGCGCAGCTCTACAAGTCCCAAACCAGGCGAGCCAGTGGCAACAGGGGTTAACAGGTTGTGTAAAATCTTCATTAATTTGATATGTTTATAGCAGCGTTTAGTGTGTCTTCAGTGCTTATATTACTGTACCCTTATCATAGAATAATATGGCTATGAAGATGGCAAAAAATCTGGGGTCATAGCTTATCAAATGCGTATTTACAAAACGAACCTTTTATTTCCGTTACAAAAACTTTTCTGGCCAACAATAAACCTTACTAAAGAATGTTCTGGGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4170
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089827 Essential Splice Site 381 678 7 15
Genomic Location (Zv9):
Chromosome 22 (position 23339288)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24442568
GRCz11 22 24469132
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTCTTCAGAGCTACTGGAGCAGTTCAGGTGGTAGAGAAGATGCGAACAG[G/A]TAGGAGTACTCAAAATATGAATATACAWTTGAAGTCAGATTTATTAGCCC
Long Flanking Sequence:
ATGTCATATATTTGTTTTAAGTCTGTATTTTGTTGGTCAGATTAAAAAAGCACTAGAAAATTAATATCATAAGTCTTTAAATAGATAATATATTTAATATAGTATATTTTTGTTTCTTTCTTTTTTTTTTTGTGTGTTGCATTGCGTTGCATACCAGAGCAGTTTCAGAATATTGCTCTTTCTGTCAACATTTGACTAGCCAGACTCTCTTTGGGGTTTTCTTTTAAATAAATGTCCTAAAACAGTTCAAATGTATCTTGAAGGAACCAGGAAATGTTTCAATCTCATAACAGTATTGAATAGCAGCAGGTGCTTCTGTGAGCTCTAAAATGAAAGCGTCAACCTCTATCGCCCCCTTGTGGTGGACTCATCTAATATTCCGACATCTTTTATAAAGCTCTTTATATCATATTATTTTAAGGCTTTTCATGTACACTTTCCACATTTGTGACTCTTCAGAGCTACTGGAGCAGTTCAGGTGGTAGAGAAGATGCGAACAG[G/A]TAGGAGTACTCAAAATATGAATATACATTTGAAGTCAGATTTATTAGCCCCCTTGTTTATTTTATCCCCCAATTTTTGTTTAATGGAGGGAAGATTTTATTCAACACATTTGTAAACATAATAGTTTTAATAACTCATTTCTAATAACTGATTTATTTTCTCTGTCATGATCACAGTATGTAATATTTTACTAGGTATTTTTCAAGACACTAAAATGTATTTACCTAAAGTGACATTTAAAGGCTTAACTAAGTTAATTAGGTTAACTAGGCAGGTCAGGGTAATTAGGCAAGTTATTATATAACGATGGTTTGTTCTGTAGACTATCAAAAAAAAAAAAAAAAAAGCATCGCTTAAAGGGGCTAGTAATTTTGACCTTTTAAAAAAATAAAAACTGCTTTTATTTAGTCCGAAATAAAACAAATAAGAATAAAGAATAAAGAAATAATATGATCAAACATACTTTGAAAAGTTCCTTGCCCTGTTAAACATCATTTAGA
Associated Phenotype:
Not determined