Busch Lab

ZMP

aspm

Ensembl ID:
ENSDARG00000071442
ZFIN ID:
ZDB-GENE-050208-620
Description:
asp (abnormal spindle)-like, microcephaly associated [Source:RefSeq peptide;Acc:NP_001116845]
Human Orthologue:
ASPM
Human Description:
asp (abnormal spindle) homolog, microcephaly associated (Drosophila) [Source:HGNC Symbol;Acc:19048]
Mouse Orthologue:
Aspm
Mouse Description:
asp (abnormal spindle)-like, microcephaly associated (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:13

Alleles

There are 22 alleles of this gene:

Allele Name Consequence Status Availability
sa24172 Nonsense Available for shipment Available now
sa447 Essential Splice Site Confirmed mutation in F2 line Not yet available
sa12763 Nonsense Available for shipment Available now
sa37518 Nonsense Available for shipment Available now
sa17838 Nonsense Available for shipment Available now
sa24171 Essential Splice Site Available for shipment Available now
sa43849 Nonsense Mutation detected in F1 DNA Not yet available
sa43848 Nonsense Mutation detected in F1 DNA Not yet available
sa43847 Nonsense Mutation detected in F1 DNA Not yet available
sa1008 Nonsense Available for shipment Available now
sa9075 Nonsense Mutation detected in F1 DNA Not yet available
sa24170 Nonsense Available for shipment Available now
sa37517 Nonsense Mutation detected in F1 DNA Not yet available
sa24169 Nonsense Available for shipment Available now
sa11648 Nonsense Available for shipment Available now
sa13529 Nonsense Available for shipment Available now
sa5003 Essential Splice Site F2 line generated Not yet available
sa6712 Nonsense Mutation detected in F1 DNA Not yet available
sa37516 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa24172
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 91 3411 1 30
ENSDART00000126795 Nonsense 91 3391 1 29
Genomic Location (Zv9):
Chromosome 22 (position 24352033)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23520711
GRCz11 22 23547275
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTACAGTCATTGTGGATAAAATCTCAGCATCCAAGGGCTTTTCGGTGGAT[C/T]AAATGTCGTTCACAATACAGGTAATAGCAAATATACAAATGATTATGTGT
Long Flanking Sequence:
GATTTTTAAAGAAATCCTAGAGCTGCGATTGGCTCGATTTTACGCTTCTATGCAGTGATTGGACAATTCTATGAGCAGCAAAGAGCTGATTGGCCGCCTGGCCTGCACGCAAAATTCAAACGTACGAATGCGTGCTCTGTTTTGAAACGGTATTTGTAGTTCAGCTCAGCAGCACTGACACATGGATTTACCAACTTCGTTGTTCGCTTAGATGAGCCATAAACATAAACATGTCGTTTAAAGTAGCGAAATCGGAGTGTTTGGACTTCAGTCCACCGCTTGATTCTCACTGTAGTCGCGATAAATCCGGTAAGGAAAACAGCAGTTCGATTCCTGTGCTGAGTTTACTTCAGTTTTCCAGAGCTCCTTTCGTGTCGTTCGGGACGATCAAGTTGGGATCTTCGAAATCTTTACCTTTACGAATTGAAAATCCCACTGATGATGCCACAGCTACAGTCATTGTGGATAAAATCTCAGCATCCAAGGGCTTTTCGGTGGAT[C/T]AAATGTCGTTCACAATACAGGTAATAGCAAATATACAAATGATTATGTGTCATAAATGTGTAAATATGTTAATAGAAAGCATATTAAACAAATTTAAATGTCCATTTGTAGCCACGTATATACACAGTGAATGTTCACAACTGCATAGAAAAAAATTAATTTTTAGTAACTACAGTATAACTACTACAGTAGATTAAAGTGAAGGACTTCAGTTTATGAGGTAACTAAAACAATAACTATAGTAACCTATTTTATGTAACGTCACCAATACCAAGCTTTTTACAACTAGGCATGTTATACCACTTTAATTGAGTTTTACTATAGTAAATTGTGGTGTATACCACAGTAGTTATTGCAGTAACGTTATGCCAGTTCACTGTAGCTAATACTGCCTACATCATGCTGAAGTATTCACATTGACTAAATGTTGTAAATACAATGCAGTATAAAACTATTAATTGCAACATTATTTTTCACATGTGGTCATGCTTGATGCACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa447
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Essential Splice Site 97 3411 1 30
ENSDART00000126795 Essential Splice Site 97 3391 1 29
Genomic Location (Zv9):
Chromosome 22 (position 24352012)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23520732
GRCz11 22 23547296
KASP Assay ID:
554-0325.1 (used for ordering genotyping assays)
KASP Sequence:
TCTCAGCATCCAAGGGCTTTTCGGTGGATCAAATGTCGTTCACAATACAG[G/T]TAATAGCAAATATACAAATGATTATGTGTCATAAATGTGTAAATATGTTA
Long Flanking Sequence:
GCTGCGATTGGCTCGATTTTACGCTTCTATGCAGTGATTGGACAATTCTATGAGCAGCAAAGAGCTGATTGGCCGCCTGGCCTGCACGCAAAATTCAAACGTACGAATGCGTGCTCTGTTTTGAAACGGTATTTGTAGTTCAGCTCAGCAGCACTGACACATGGATTTACCAACTTCGTTGTTCGCTTAGATGAGCCATAAACATAAACATGTCGTTTAAAGTAGCGAAATCGGAGTGTTTGGACTTCAGTCCACCGCTTGATTCTCACTGTAGTCGCGATAAATCCGGTAAGGAAAACAGCAGTTCGATTCCTGTGCTGAGTTTACTTCAGTTTTCCAGAGCTCCTTTCGTGTCGTTCGGGACGATCAAGTTGGGATCTTCGAAATCTTTACCTTTACGAATTGAAAATCCCACTGATGATGCCACAGCTACAGTCATTGTGGATAAAATCTCAGCATCCAAGGGCTTTTCGGTGGATCAAATGTCGTTCACAATACAG[G/T]TAATAGCAAATATACAAATGATTATGTGTCATAAATGTGTAAATATGTTAATAGAAAGCATATTAAACAAATTTAAATGTCCATTTGTAGCCACGTATATACACAGTGAATGTTCACAACTGCATAGAAAAAAATTAATTTTTAGTAACTACAGTATAACTACTACAGTAGATTAAAGTGAAGGACTTCAGTTTATGAGGTAACTAAAACAATAACTATAGTAACCTATTTTATGTAACGTCACCAATACCAAGCTTTTTACAACTAGGCATGTTATACCACTTTAATTGAGTTTTACTATAGTAAATTGTGGTGTATACCACAGTAGTTATTGCAGTAACGTTATGCCAGTTCACTGTAGCTAATACTGCCTACATCATGCTGAAGTATTCACATTGACTAAATGTTGTAAATACAATGCAGTATAAAACTATTAATTGCAACATTATTTTTCACATGTGGTCATGCTTGATGCACAAAGCTATTAGTAGTTTAGCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12763
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 509 3411 3 30
ENSDART00000126795 Nonsense 509 3391 3 29
Genomic Location (Zv9):
Chromosome 22 (position 24348535)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23524209
GRCz11 22 23550773
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTGGAATCGAAAATTTGTCCAGTTGCAAAAAAGAAGYCAACTTYAAATT[T/A]ATCCCCTCATGACCAACTTTTGTCCTCTATTTCTCCCATACGACCTMAAG
Long Flanking Sequence:
TTCTGATTCTCTGGAATCTGACAAACCGGACCCAGGAGCGTCCTTTAGAGCAAGAAGAGTCATTTCACCACCAGTTGAAACTGCTGACCCGAGGTTGACTTTCTGTGTGAAACCCAACAAAGCCATAGGCATTGCATCAAATCAAGATGAATTTAGGCTCAAGGCTTTACCTTTTAGCACCGCCACAGTGACAAAGTCAATTAAAGTAGATGACACCCATGTCCCAGATGACCCCAAGACGTTTCCTGTTAATTCTGCCACAGTGGTCAAAAGCAAAGCAGATGCTTCTGTTGAGAGTCCAGGACTGCGTAAGAAGAAAACCTCAAGGCGCAGACTCTTGGAGAAGACATTGGAGCTTTCAGAGCCTAGTAATGCAGAATCCAACACAAGTTCTCCTGACAGCTTCTCTGCTCTACCAGTCATCAACTCCGATTCAAGTCCAGATCTGCCACTGGAATCGAAAATTTGTCCAGTTGCAAAAAAGAAGCCAACTTTAAATT[T/A]ATCCCCTCATGACCAACTTTTGTCCTCTATTTCTCCCATACGACCTCAAGTTTTCCCCTCTGTTAGTAATAGTCCGTCAAGCAGCTTAGAGCTGTCAGCCAGTCATTTCTCTGAAAAAGTAAAACCAAATCTTTTGGAGAATCAGTTTCCCGTGCAAAGCAGGACATTAGTGCAAAGTAAAAAAAGAAAAAGCGATGAGTTTTTGAGAGGTCACTCAGAAGACAAGTCAAACATCCAAGCAAAAAAATGCCGAGCTCCTGCGCAGGCAACTGAGAAACCAAGTCAAGAAAGAACACTTACTTCAAGGTCTACATCTGGACCACAACGAAAAGCTGTTGGTGAGTCAAGTATGCGCAATAGAGCTGTGGCAAAAAATCATTTGAGACATTGATTCTGAGATTTTCAAAATGCATTATTCCAATGCTTCCCAATTCCAGTCCTCGGGAACAGCAGGTGGCACTCTAAGCTAGTTTTAACACCAGATGGCACTCTATGCTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37518
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 657 3411 5 30
ENSDART00000126795 Nonsense 637 3391 4 29
Genomic Location (Zv9):
Chromosome 22 (position 24347509)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23525235
GRCz11 22 23551799
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTTCACTGATGTAGATGCTCGGTCTGTGAAGTCAGCCAATAGCTCAACT[C/T]GAAAGACTGCGAGGATAGTAGCTGTGGCACAGGCCAGACTGACCTTTATG
Long Flanking Sequence:
CGAGTAAGAGTGCTTGTGCATTCATGAAGGTTGGCTTTTATGTCATAAGATTAATGTAAAAACAACTCACTTTGAACACTTAATGCGCTTGAATCAATTTCAAGCTTTAAGTATATTTTTAGGTATGAGTGGTATTTGTAAGGAATTAGTTTCAAACAGAATAAAGCTGATTGTAAAGCATACAACGCTATCAGAATCAATTCAAGAGAGAATAGCGAAAAACTCAGAATCTACACAAGATTTCTCGAGCGATTTACTGTAAGAGGTGTTTGGATGTTGTTTAATTTGAGACTTTTTTTCTTAAAGCACCCCCAAGCTCAAGAAAATTCACAAGGTTTCCACCAAAGAAAATCTCTCCAAAAACAGCTCAAAAAGGTACAATCCTTCTTAAGAATATCCTGAAATACACTTGCTATTAGTATGACCAGTCAGCTATATGATTTAAAACATGTTTCACTGATGTAGATGCTCGGTCTGTGAAGTCAGCCAATAGCTCAACT[C/T]GAAAGACTGCGAGGATAGTAGCTGTGGCACAGGCCAGACTGACCTTTATGAAGCCGACACAGACGGGTATGCTTTTACAGCTTTATTCATACAATTTTATGTATTTGTAAGATGCATAGTTACTTATGTTGTAAAATCCTGACAGCCATTCCAAGGCATCCATTGCCATTTGCGGCAAAAAACATGTTTTATGATGAGCGATGGATCGAAAAGCAAGAGCGAGGCTTTACTTGGTGGATGAACTACATTCTCACTCCTGATGACTTCAAAGTTGCTACTGAAGTTACCAAAGGTAGGCACTTAGTTGGAGTGATTGTATCCTAAAGTAATTGGATATCAACAAAGTTCTCATCTCACTTTAATGTTGTTCCAAACGTGTAAGTTATTTTGTTCAACTTTGGAGCACAAATGAAGATATTTCAGGTGAAACCCTAGAGCTCTCTTACCTTTTATAAACAACAAGGGTCCCAAGACCTTTAAAGTCCAGAAAGGTACCAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17838
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 697 3411 6 30
ENSDART00000126795 Nonsense 677 3391 5 29
Genomic Location (Zv9):
Chromosome 22 (position 24347310)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23525434
GRCz11 22 23551998
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCCAAGGCATCCATTGCCATTTGCGGCAAAAAACATGTTTTATGATGAG[C/T]GATGGATCGAAAAGCAAGAGCGAGGCTTTACTTGGTGGATGAACTACATT
Long Flanking Sequence:
ATTCAAGAGAGAATAGCGAAAAACTCAGAATCTACACAAGATTTCTCGAGCGATTTACTGTAAGAGGTGTTTGGATGTTGTTTAATTTGAGACTTTTTTTCTTAAAGCACCCCCAAGCTCAAGAAAATTCACAAGGTTTCCACCAAAGAAAATCTCTCCAAAAACAGCTCAAAAAGGTACAATCCTTCTTAAGAATATCCTGAAATACACTTGCTATTAGTATGACCAGTCAGCTATATGATTTAAAACATGTTTCACTGATGTAGATGCTCGGTCTGTGAAGTCAGCCAATAGCTCAACTCGAAAGACTGCGAGGATAGTAGCTGTGGCACAGGCCAGACTGACCTTTATGAAGCCGACACAGACGGGTATGCTTTTACAGCTTTATTCATACAATTTTATGTATTTGTAAGATGCATAGTTACTTATGTTGTAAAATCCTGACAGCCATTCCAAGGCATCCATTGCCATTTGCGGCAAAAAACATGTTTTATGATGAG[C/T]GATGGATCGAAAAGCAAGAGCGAGGCTTTACTTGGTGGATGAACTACATTCTCACTCCTGATGACTTCAAAGTTGCTACTGAAGTTACCAAAGGTAGGCACTTAGTTGGAGTGATTGTATCCTAAAGTAATTGGATATCAACAAAGTTCTCATCTCACTTTAATGTTGTTCCAAACGTGTAAGTTATTTTGTTCAACTTTGGAGCACAAATGAAGATATTTCAGGTGAAACCCTAGAGCTCTCTTACCTTTTATAAACAACAAGGGTCCCAAGACCTTTAAAGTCCAGAAAGGTACCAAGAAGAGTCAAAGGTCCAATCCCAATTCTACCCCTTAGCTCTTCCCCTTACCTACCTTTCGTTTAGCATGATCACGTGAAGGGAAAGGGCTAGATAGCCTTTAAACTGAGATTTTCCCAGACCAAACTCGAAACCAAGGGGTACACAAAATAGAATAGGGCCAAAGTATTTCACAGTGGTTCAACCTTAATTTCATGAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24171
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Essential Splice Site 829 3411 8 30
ENSDART00000126795 Essential Splice Site 809 3391 7 29
Genomic Location (Zv9):
Chromosome 22 (position 24345208)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23527536
GRCz11 22 23554100
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAACTGGCTCATATCGTACAATCCACTTTGGCTGCGAATTGGACTTGAG[G/A]TATTTACTTTTCATTGTAAAAGCATACTGTTTGTCTCATCACTTGCTGAA
Long Flanking Sequence:
ACTATGAGGATTTTAAAAGCATTCAGGAATAAAAAATTGTACCGTTTGTAACTTAAATCATGATTAATTTTCTTGAATTATTTTTATTGTTTAATTACTGTATCGGATTACTGTTTACACTGTTTATATAATGTATTTCTATTGTATCTTTTTTATTGATCTATGCTTGTATACAATATGAATAACAAAATTTGTTAGATTTTTCCAATATCGTTCAGCCCTTATTTGGAATTATAATTGTTAAAATCACAACGATCCTTTTGAATAATACTATTCAAATTATAGTTCTTATTATCAGCAATGTTATTTTATTGTTCATATCATTTCTAGCTGGTTTTTGCCTGAGGATGTTAAGTTTTTAGCATTTTAATGAATGAATTAGATTTTCTTAAGCTACTGCTTTTTCTTATTTTCTCAATTTTTATTTCTCAGGTGAGCGCCAGAAAGTTCTCAACTGGCTCATATCGTACAATCCACTTTGGCTGCGAATTGGACTTGAG[G/A]TATTTACTTTTCATTGTAAAAGCATACTGTTTGTCTCATCACTTGCTGAAAATTCAATCAGCCACATTTTGATCCAATGCATGACACGTCTCTAACTCGTTCTGTGTTTCAGACAATTTATGGAGAGCTAATATCACTGGAAAGCAACAATGATGTCATGGGACTGGCCATGTTTATTCTTGGGCGTCTGCTGTGGAACCCAGATTTAGCCGCTGAGTTCAGACACTCTAAAGTGCCGCATTTGTATAGAGATGGTAACTTAATTTACTGTATTTTCAATATCTACTGTATTTTACTCTTAATTTTGCCCACAAGAAATGTTTAGCAACCTTTACTCCAACGTGACACGCATTCCTCATTTAATGTAAAGAAAGCCAAAAAATACAAAGCTTATATACCTCATAAATATAAAAATAATTGAAAAAAATTTTTTTTTTATTGCTCATTACACAGGAATCAGATGTTGCGACCTTTTTATTTTTCGATTTATGATGCAGGTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3204
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 1121 3411 14 30
ENSDART00000126795 Nonsense 1101 3391 13 29
Genomic Location (Zv9):
Chromosome 22 (position 24339758)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23532986
GRCz11 22 23559550
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATCCCAGTCAGAAAGTGACGCTTCTTATGGACTGGGTYAATGCTGTTTG[T/A]GAGTTCTACAGCTTGAAGGTGATTAGGAAAAAGTTTCCTTGTGTATTGAG
Long Flanking Sequence:
TATTATAGGTTGCTTAAGTTTTGGTCAATCACTACTAACTAACTAACAGTTACTCATCAAATATTATGTATTTGGAAGCTCTACATTTGTTGTCTTTGCTATTTTGAAGGAGCAAACATTGACTCCAGAGACATTGTGGATGGACATAGGGAAAAGACCCTAAACCTCCTGTGGAAAATCATATTTGCCTTTCAGGTATCCGCCATACCATATAGTCCAGCCTCATTTGGATCATTTATTATTTTGATTATTATACGTGCTTAAATCTAGACCTTGTGTTCTGTTTTTATACTTCTGTCTGCATAGGTGGAAGTGCTGCTTGATGAGAATCAGCTCAAAGAAGAAATCAGTTTCCTCAGGAAAACCTGGAGAACAAAACAGAAACTGGCCTCAATAATGGCTAACAACAGTGTTACGGTGTCGAGAATGAAGGCGAGACGAGCATTTGAGCATCCCAGTCAGAAAGTGACGCTTCTTATGGACTGGGTCAATGCTGTTTG[T/A]GAGTTCTACAGCTTGAAGGTGATTAGGAAAAAGTTTCCTTGTGTATTGAGTTTTATGTGCAAACGTTTTATAATAGAACACTCACCATTACAAAACTGATTATTACAGATTACTTATTATTTTTTTAAATGAACAACAAAATAACATGGAAAAATAAATTAACAATAATCATTGAATAAATGTTATACAATCTTTTTATTATCTGTCAATCCCAATCACATGTCCAGAATTATTAATTTGACTAAATTATCATTAATTTGACTAAATCTGCGGAATAAATAGTAAAAAGGGCTGATGCAGCTTTTAAACAGAAGCCAAGATGTTAAAAGATTTAAAGTAAATTAAAAAATATATATATTTTATCTACTATTGGGAAGTTGGAGGCTTCTTAAAGATCTGGTCGAATAGTGTATATGAAACCTATCTAACAGTGAGGTCAAGGCTAAAATATCAAGTTGCCTAGAATTAAACGGAGATCAGATCCTTTGTAGTCGATAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43849
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 1194 3411 15 30
ENSDART00000126795 Nonsense 1174 3391 14 29
Genomic Location (Zv9):
Chromosome 22 (position 24338919)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23533825
GRCz11 22 23560389
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAACTCCTCCAGTGACTCGGATTGCTCTTTTGAAAATTTGGCCACAATG[C/T]AGTCTGGTAAGTTGAGTTGAGTTGCCCAAAGTTATGTTGGCTTCTTTGAA
Long Flanking Sequence:
AAATTAAAAAATATATATATTTTATCTACTATTGGGAAGTTGGAGGCTTCTTAAAGATCTGGTCGAATAGTGTATATGAAACCTATCTAACAGTGAGGTCAAGGCTAAAATATCAAGTTGCCTAGAATTAAACGGAGATCAGATCCTTTGTAGTCGATAAATTGGTAAATTAGGATGTGTATCCATACTGACCTTTAACACCTTCGACATTAGCCTGTGTTTTGTTGTGTAGAGATATTTCTGGTTGTATAGGATCTTTCTTTAAAACAGCATCTTTCTCTTTTCTTTTTTTTTTTTAACAGGCTGAAAACTTCACCGTGTCATTCTCAGATGGTCGTATCCTCTGCTACCTCATCCATCATTATCATCCTGGTCATCTCCATGCAGAGGAGATTCAACAGAGAACCACACAGACCATTGAATGTGGTCATCGTGGCAGAGTTGAACTCAATAACTCCTCCAGTGACTCGGATTGCTCTTTTGAAAATTTGGCCACAATG[C/T]AGTCTGGTAAGTTGAGTTGAGTTGCCCAAAGTTATGTTGGCTTCTTTGAAGCACTGTTTCAGGCCATGTCTACACTAATACATAGTCATTTAAAAACACAAGTTTCTCACTATTTTGGTGATGTCTTTATCTAAGTTTTTGCACTTCTCCCAGTATGTAATACTAGCGTTTCTAGCTTCTCCTTTGTTACTCGCAGCAACTGTTGGTCCATTAAAAAAATCTCTGTTTTTCCTTGACATGTTGCCACAATGTTTCAAAGAGCCAGTAACCCAAAAACATCAGGCAGAAATGACACAGGTCGAAGCATGTTTTTTCATGTAGTTTTAGTGTGGATGACCAACTTTAAACAATTAAAAACAATACTTTGGAGTGTTTTAGATGAAAATGCTTTTTTTTCAAATTTATTTAGATTTATTGTAGATACAAGCTGTGTCTCCTTTCAGAGGCTGCAAATCCTTCACAGCCTTGAGCATCTCAAGATTCATTGCGCAAAAACTCCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29787
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 1460 3411 19 30
ENSDART00000126795 Nonsense 1440 3391 18 29
Genomic Location (Zv9):
Chromosome 22 (position 24333877)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23538867
GRCz11 22 23565431
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCAGAGTGCATTCAGGGCCTACCTCATCAGGAAAGAGTTATCTAAAATG[A/T]AGCAAAATGCAGTCTTGATTCAGAGGTGGTTTCGAGCCTGCGTGCAAAGG
Long Flanking Sequence:
AGCTGAGAGTGCTGAAAAAAGAGAGACATTATGCACTTCAAAATGCTGCTGCAACCTTAATCCAGGTTCTCATTTGTTTATTCTGTATTGATTTGTTATGAATTCCTTTCATTAATAGATAATGTTGTTATAGTGATTTCAAATGGCTAATATAAAATTTTCTTGTGTTCCACCAGAAAACGTACAAAGCTTGGAGGGTTAAGAATCTCCTAAAGAAGAACCGTTCCGCCTTTGTGATTCAGGCAGCTTTCCGGAAATGGCATGCAAAGAAAATGCTGGAAAGAAACACTGCAGCTTTGCGCATTCAAGCATGGTACAGAATGCAGCTGTGTAAAAGACAATACTTGGAAATGAAACGGAAAGCAGTCTGCGTTCAAGCATGGTTTAGAGGGCACCTTCAAAGATCCAAGTTTCAGAATTTAAAGAAAAGACATCATGCTTCAGTTGTCATTCAGAGTGCATTCAGGGCCTACCTCATCAGGAAAGAGTTATCTAAAATG[A/T]AGCAAAATGCAGTCTTGATTCAGAGGTGGTTTCGAGCCTGCGTGCAAAGGAAAGCAGAACAGAAGAGGTATTTTGAGATTAAATCGGCTGTTCTCGTTCTGCAAGCAGCTTTCCGTGGTTGGAAGGTCCGTAAATCTGTTGCTCAACACCACCGATCTGCACTAGTAATTCAAACTGCCTTTAGGAGGTTTACTGCACAAAGGCATTTTTTGTGCTTGAAAAGATCAGCCATAGTTCTGCAACAGAGATACAGAGCTAAAGTGCATGGAGGCAAGTTCCGGAAAGAATACATGGCTCTTAAATCCGCTTCAGTGAGAATTCAAGCAATGTGGCGAGGACGAGCCGAGAGGAAGAAGATCAGTCAACTCCACAGATTTGCCAAAATCATTCAGTCAAACTATCGGAGGCATCTGGAACAGACAAGGTTTTTGCAAATGAAACGGGCTGCTGTAGTTATTCAAAGACAATACAGAGCTTTCAGAGATGGACAGAAAGTGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43848
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 1716 3411 19 30
ENSDART00000126795 Nonsense 1696 3391 18 29
Genomic Location (Zv9):
Chromosome 22 (position 24333107)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23539637
GRCz11 22 23566201
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCCACTATATGCGATTGAGAAAGGCAACTATAACCATGCAGGCCATATA[T/A]CGGGGTTCCAAAGTGAGGCAGAATTTAAAAAGAGAACATCAAGCTGCTAC
Long Flanking Sequence:
GGCAAGTTCCGGAAAGAATACATGGCTCTTAAATCCGCTTCAGTGAGAATTCAAGCAATGTGGCGAGGACGAGCCGAGAGGAAGAAGATCAGTCAACTCCACAGATTTGCCAAAATCATTCAGTCAAACTATCGGAGGCATCTGGAACAGACAAGGTTTTTGCAAATGAAACGGGCTGCTGTAGTTATTCAAAGACAATACAGAGCTTTCAGAGATGGACAGAAAGTGCATGCAGAATACACCAAAATCAAAAGAGCGGCCATTATACTACAGAGTGCGTATCGTGGGAGGAGAATAAGACAAGAACTGCAGAGGAAAAACAAAGCTGCGACTTTGATTCAGTCTGTGATGAGAGCACATATGTGCCATCAGCAGTTTTTAGCTCAAAAACATGCTGCTATTGTCATTCAGCAGCAGTTTCGGGCTTTTACATTTGGACGAATGGAAAGAAGCCACTATATGCGATTGAGAAAGGCAACTATAACCATGCAGGCCATATA[T/A]CGGGGTTCCAAAGTGAGGCAGAATTTAAAAAGAGAACATCAAGCTGCTACTGTCATTCAAGCCCAATTCCGAATGCATAAGGTCCGCATTCCTTTTGTTGCCGCAAAGTGTGCAGCTATCCTTATACAGCAGCATTATAGAGCCTATAAGGTTGGCAAAACTGTGCAAGCTACTTATTTACAAATGAAAAATGCGGCCGTAGTTATTCAGTCAGCTTTCAGGGGGATGAAAGTTCGCAACTACTTACGAAAATCTCACCAAGCTGCAAAAGTGATTCAGGCACATTTCCGTGGACATTCCCAACTCAAAAAGTACCGGAGACAACAGTGGGCCGCATCAGTTTTACAGCAACGATTCAGAGCAACGGTGACCAAAAATGCTGTCATGAAGCAATATGCAGCCATAAAAACTGCAACAATATGTATTCAGTCTGCTTTCCGCGGAATGGTGGCGAGAAAGCAGATCGCAGAAAAGCAAAAATGTGCTAAAATTATCCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43847
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 1809 3411 19 30
ENSDART00000126795 Nonsense 1789 3391 18 29
Genomic Location (Zv9):
Chromosome 22 (position 24332830)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23539914
GRCz11 22 23566478
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAAAGTTCGCAACTACTTACGAAAATCTCACCAAGCTGCAAAAGTGATT[C/T]AGGCACATTTCCGTGGACATTCCCAACTCAAAAAGTACCGGAGACAACAG
Long Flanking Sequence:
CGTATCGTGGGAGGAGAATAAGACAAGAACTGCAGAGGAAAAACAAAGCTGCGACTTTGATTCAGTCTGTGATGAGAGCACATATGTGCCATCAGCAGTTTTTAGCTCAAAAACATGCTGCTATTGTCATTCAGCAGCAGTTTCGGGCTTTTACATTTGGACGAATGGAAAGAAGCCACTATATGCGATTGAGAAAGGCAACTATAACCATGCAGGCCATATATCGGGGTTCCAAAGTGAGGCAGAATTTAAAAAGAGAACATCAAGCTGCTACTGTCATTCAAGCCCAATTCCGAATGCATAAGGTCCGCATTCCTTTTGTTGCCGCAAAGTGTGCAGCTATCCTTATACAGCAGCATTATAGAGCCTATAAGGTTGGCAAAACTGTGCAAGCTACTTATTTACAAATGAAAAATGCGGCCGTAGTTATTCAGTCAGCTTTCAGGGGGATGAAAGTTCGCAACTACTTACGAAAATCTCACCAAGCTGCAAAAGTGATT[C/T]AGGCACATTTCCGTGGACATTCCCAACTCAAAAAGTACCGGAGACAACAGTGGGCCGCATCAGTTTTACAGCAACGATTCAGAGCAACGGTGACCAAAAATGCTGTCATGAAGCAATATGCAGCCATAAAAACTGCAACAATATGTATTCAGTCTGCTTTCCGCGGAATGGTGGCGAGAAAGCAGATCGCAGAAAAGCAAAAATGTGCTAAAATTATCCAAAAGATGTATAGAGCATACAAACAACGTCATGATTACCTTGCTCTTAGGAATGCCACAATTCGTATTCAGCAACAATACAGAGCAGTTGTAAGTGCAAGGCAACAGCATCAAAGGTATTGCTCCTTGCGAGCAGCTGCCATCACTTTGCAGTCTTCTTACAGAGGGTTGAGGGCAAGAAAAGAAATCAATAGAAGACAAAAAGCAGCCACTGTGATTCAGGCTGCTTACAAAATGTACAGAACAAGAGTACCTTTCCAAGCCATGAAACTGGCTTCATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1008
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 1834 3411 19 30
ENSDART00000126795 Nonsense 1814 3391 18 29
ENSDART00000105628 Nonsense 1834 3411 19 30
ENSDART00000126795 Nonsense 1814 3391 18 29
Genomic Location (Zv9):
Chromosome 22 (position 24332755)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23539989
GRCz11 22 23566553
KASP Assay ID:
554-0912.1 (used for ordering genotyping assays)
KASP Sequence:
AACTCAAAAAGTACCGGAGACAACAGTGGGCCGCATCAGTTTTACAGCAA[C/T]GATTCAGAGCAACGGTGACCAAAAATGCTGTCATGAAGCAATATGCAGCC
Long Flanking Sequence:
GAGCACATATGTGCCATCAGCAGTTTTTAGCTCAAAAACATGCTGCTATTGTCATTCAGCAGCAGTTTCGGGCTTTTACATTTGGACGAATGGAAAGAAGCCACTATATGCGATTGAGAAAGGCAACTATAACCATGCAGGCCATATATCGGGGTTCCAAAGTGAGGCAGAATTTAAAAAGAGAACATCAAGCTGCTACTGTCATTCAAGCCCAATTCCGAATGCATAAGGTCCGCATTCCTTTTGTTGCCGCAAAGTGTGCAGCTATCCTTATACAGCAGCATTATAGAGCCTATAAGGTTGGCAAAACTGTGCAAGCTACTTATTTACAAATGAAAAATGCGGCCGTAGTTATTCAGTCAGCTTTCAGGGGGATGAAAGTTCGCAACTACTTACGAAAATCTCACCAAGCTGCAAAAGTGATTCAGGCACATTTCCGTGGACATTCCCAACTCAAAAAGTACCGGAGACAACAGTGGGCCGCATCAGTTTTACAGCAA[C/T]GATTCAGAGCAACGGTGACCAAAAATGCTGTCATGAAGCAATATGCAGCCATAAAAACTGCAACAATATGTATTCAGTCTGCTTTCCGCGGAATGGTGGCGAGAAAGCAGATCGCAGAAAAGCAAAAATGTGCTAAAATTATCCAAAAGATGTATAGAGCATACAAACAACGTCATGATTACCTTGCTCTTAGGAATGCCACAATTCGTATTCAGCAACAATACAGAGCAGTTGTAAGTGCAAGGCAACAGCATCAAAGGTATTGCTCCTTGCGAGCAGCTGCCATCACTTTGCAGTCTTCTTACAGAGGGTTGAGGGCAAGAAAAGAAATCAATAGAAGACAAAAAGCAGCCACTGTGATTCAGGCTGCTTACAAAATGTACAGAACAAGAGTACCTTTCCAAGCCATGAAACTGGCTTCATTGGTAATACAGAGGCAGTACAGGTGCCATTTACTGAGAAAAAAGGCAAGAGAGAACTTCTTAAAACTAAAGCAGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9075
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 1834 3411 19 30
ENSDART00000126795 Nonsense 1814 3391 18 29
ENSDART00000105628 Nonsense 1834 3411 19 30
ENSDART00000126795 Nonsense 1814 3391 18 29
Genomic Location (Zv9):
Chromosome 22 (position 24332755)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23539989
GRCz11 22 23566553
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AACTCAAAAAGTACCGGAGACAACAGTGGGCCGCATCAGTTTTACAGCAA[C/T]GATTCAGAGCAACGGTGACCAAAAATGCTGTCATGAAGCRATATGCAGCC
Long Flanking Sequence:
GAGCACATATGTGCCATCAGCAGTTTTTAGCTCAAAAACATGCTGCTATTGTCATTCAGCAGCAGTTTCGGGCTTTTACATTTGGACGAATGGAAAGAAGCCACTATATGCGATTGAGAAAGGCAACTATAACCATGCAGGCCATATATCGGGGTTCCAAAGTGAGGCAGAATTTAAAAAGAGAACATCAAGCTGCTACTGTCATTCAAGCCCAATTCCGAATGCATAAGGTCCGCATTCCTTTTGTTGCCGCAAAGTGTGCAGCTATCCTTATACAGCAGCATTATAGAGCCTATAAGGTTGGCAAAACTGTGCAAGCTACTTATTTACAAATGAAAAATGCGGCCGTAGTTATTCAGTCAGCTTTCAGGGGGATGAAAGTTCGCAACTACTTACGAAAATCTCACCAAGCTGCAAAAGTGATTCAGGCACATTTCCGTGGACATTCCCAACTCAAAAAGTACCGGAGACAACAGTGGGCCGCATCAGTTTTACAGCAA[C/T]GATTCAGAGCAACGGTGACCAAAAATGCTGTCATGAAGCAATATGCAGCCATAAAAACTGCAACAATATGTATTCAGTCTGCTTTCCGCGGAATGGTGGCGAGAAAGCAGATCGCAGAAAAGCAAAAATGTGCTAAAATTATCCAAAAGATGTATAGAGCATACAAACAACGTCATGATTACCTTGCTCTTAGGAATGCCACAATTCGTATTCAGCAACAATACAGAGCAGTTGTAAGTGCAAGGCAACAGCATCAAAGGTATTGCTCCTTGCGAGCAGCTGCCATCACTTTGCAGTCTTCTTACAGAGGGTTGAGGGCAAGAAAAGAAATCAATAGAAGACAAAAAGCAGCCACTGTGATTCAGGCTGCTTACAAAATGTACAGAACAAGAGTACCTTTCCAAGCCATGAAACTGGCTTCATTGGTAATACAGAGGCAGTACAGGTGCCATTTACTGAGAAAAAAGGCAAGAGAGAACTTCTTAAAACTAAAGCAGAGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5004
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 1885 3411 19 30
ENSDART00000126795 Nonsense 1865 3391 18 29
Genomic Location (Zv9):
Chromosome 22 (position 24332600)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23540144
GRCz11 22 23566708
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGCAGATCGCAGAAAAGCAAAAATGTGCTAAAATTATCCAAAAGATGTA[T/A]AGAGCATACAAACAACGTCATGATTACYTTGCTCTTAGGAATGCCACAAT
Long Flanking Sequence:
TCCAAAGTGAGGCAGAATTTAAAAAGAGAACATCAAGCTGCTACTGTCATTCAAGCCCAATTCCGAATGCATAAGGTCCGCATTCCTTTTGTTGCCGCAAAGTGTGCAGCTATCCTTATACAGCAGCATTATAGAGCCTATAAGGTTGGCAAAACTGTGCAAGCTACTTATTTACAAATGAAAAATGCGGCCGTAGTTATTCAGTCAGCTTTCAGGGGGATGAAAGTTCGCAACTACTTACGAAAATCTCACCAAGCTGCAAAAGTGATTCAGGCACATTTCCGTGGACATTCCCAACTCAAAAAGTACCGGAGACAACAGTGGGCCGCATCAGTTTTACAGCAACGATTCAGAGCAACGGTGACCAAAAATGCTGTCATGAAGCAATATGCAGCCATAAAAACTGCAACAATATGTATTCAGTCTGCTTTCCGCGGAATGGTGGCGAGAAAGCAGATCGCAGAAAAGCAAAAATGTGCTAAAATTATCCAAAAGATGTA[T/A]AGAGCATACAAACAACGTCATGATTACCTTGCTCTTAGGAATGCCACAATTCGTATTCAGCAACAATACAGAGCAGTTGTAAGTGCAAGGCAACAGCATCAAAGGTATTGCTCCTTGCGAGCAGCTGCCATCACTTTGCAGTCTTCTTACAGAGGGTTGAGGGCAAGAAAAGAAATCAATAGAAGACAAAAAGCAGCCACTGTGATTCAGGCTGCTTACAAAATGTACAGAACAAGAGTACCTTTCCAAGCCATGAAACTGGCTTCATTGGTAATACAGAGGCAGTACAGGTGCCATTTACTGAGAAAAAAGGCAAGAGAGAACTTCTTAAAACTAAAGCAGAGTGCAGTAGCAATTCAAGCTATATACAGAGGAAAACTTGCACGCCGTGATCTTGCTAGAAGGCATTTTGCAGCCACAATCATTCAAAGAAAGTACCTTGCCTACAAACAAAGGAAGTGTTTTTTGACCCTTCAAGCTGCTGTTATATTCTGTCAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24170
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 2161 3411 19 30
ENSDART00000126795 Nonsense 2141 3391 18 29
Genomic Location (Zv9):
Chromosome 22 (position 24331774)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23540970
GRCz11 22 23567534
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGTGCAGCTTTGATTCTGCAAGCAGCCTATCGTGGCAAGAAGACCAGA[C/T]AGGCTTTGAAGCAAATGCACCAAGCTGCAACAATCATTCAGTCCCATGTG
Long Flanking Sequence:
TCTTAAAACTAAAGCAGAGTGCAGTAGCAATTCAAGCTATATACAGAGGAAAACTTGCACGCCGTGATCTTGCTAGAAGGCATTTTGCAGCCACAATCATTCAAAGAAAGTACCTTGCCTACAAACAAAGGAAGTGTTTTTTGACCCTTCAAGCTGCTGTTATATTCTGTCAACAACACTATCGATCCATTTTGCTTACAAGGCATGACCGAAAAGATTATTTGACTAAACGCAGAGCTGTGGTAGCAATCCAGGCAAGTTTCAGAGGGATGAATGTCCGGCGCCAGATCCGAAGAGAGCACAAAGCTGCAACAATCATTCAGTCCCATGTGAGAATGCGCATCCTCAACTTGCGCTTCCAGCGACTTCGATGGGCAGTCTGTACTGTTCAGCAACGTTTCAGAGCTAACAAAATCATGAGGCAAGAGATGGCAGCACTACAGGAAAAGAAAAGTGCAGCTTTGATTCTGCAAGCAGCCTATCGTGGCAAGAAGACCAGA[C/T]AGGCTTTGAAGCAAATGCACCAAGCTGCAACAATCATTCAGTCCCATGTGAGAATGCGGATCCTTAACTTGCGCTTCCAGCGACTTCGATGGGCAGTCTGTACTGTTCAGGAGCGTTTCAGAGCTAACAGAATCATGAGGCAGGAGATGGCAGCACTACAGGAAAAGAAAAGTGCAGCTTTGATTCTGCAAGCAGCCTATCGTGGCAAGAAGACCAGACAGGCTTTGAAGCAAATGCACCAAGCTGCAACAATCATTCAGTCCCATGTGAGAATGCGGATCCTTAACTTGCGCTTCCAGCGACTTCGATGGGCAGTCTGTACTCTTCAGCGACATTTCAGAGCTAACAAAATCATGAGGCAAGAGATGGCAGCACTACAGGAAAAGAAAAGTGCAGCTTTAATTCTGCAAGCAGCCTATCGTGGCATGAAGACCAGGCACACGTTGAAGCAAATGCACCAAGCTGCAACAATCATTCAGTCCCATGTGAGAATGCGGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37517
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 2309 3411 19 30
ENSDART00000126795 Nonsense 2289 3391 18 29
Genomic Location (Zv9):
Chromosome 22 (position 24331329)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23541415
GRCz11 22 23567979
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCTTTAATTCTGCAAGCAGCCTATCGTGGCATGAAGACCAGGCACACGT[T/A]GAAGCAAATGCACCAAGCTGCAACAATCATTCAGTCCCATGTGAGAATGC
Long Flanking Sequence:
AAAGAAAAGTGCAGCTTTGATTCTGCAAGCAGCCTATCGTGGCAAGAAGACCAGACAGGCTTTGAAGCAAATGCACCAAGCTGCAACAATCATTCAGTCCCATGTGAGAATGCGGATCCTTAACTTGCGCTTCCAGCGACTTCGATGGGCAGTCTGTACTGTTCAGGAGCGTTTCAGAGCTAACAGAATCATGAGGCAGGAGATGGCAGCACTACAGGAAAAGAAAAGTGCAGCTTTGATTCTGCAAGCAGCCTATCGTGGCAAGAAGACCAGACAGGCTTTGAAGCAAATGCACCAAGCTGCAACAATCATTCAGTCCCATGTGAGAATGCGGATCCTTAACTTGCGCTTCCAGCGACTTCGATGGGCAGTCTGTACTCTTCAGCGACATTTCAGAGCTAACAAAATCATGAGGCAAGAGATGGCAGCACTACAGGAAAAGAAAAGTGCAGCTTTAATTCTGCAAGCAGCCTATCGTGGCATGAAGACCAGGCACACGT[T/A]GAAGCAAATGCACCAAGCTGCAACAATCATTCAGTCCCATGTGAGAATGCGGATCCTTAATTTGCGCTTCCAGCGACTTCGTTGGGCAGTCTGTACTGTTCAGCAACGTTTTAGAGCTAACAGAATCATGAGGCAGGAGATGGCAGCACTACAGGAAAAGAAAAGTGCAGCTTTGATTCTGCAAGCAGCCTATCGTGGCATGAAGACCAGACAAACTTTAAAACAAATGCACCAGGCTGCCACCATTGTACAGGCAACTTACCGAGCTTATAGTGGACGTAAGCGGTATTTAGAAATGAAATGTGCTGCCATTGATATTCAGCAAAGATATCGGGCTGTAAATGCAGCAAAGCAGCAGAGAAAGAGTTATCTTAAAGTGCGTCAAGGTGCACTTGTTCTACAAGCGTGCTATAGAGGTCGTAAAGTTAGGAGGAACCTGCAACTACAGTGCCAAGCCGCTGTCTTGATTCAATCATATTTTAGAAGACACAAAGAGATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24169
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 2314 3411 19 30
ENSDART00000126795 Nonsense 2294 3391 18 29
Genomic Location (Zv9):
Chromosome 22 (position 24331315)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23541429
GRCz11 22 23567993
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGCAGCCTATCGTGGCATGAAGACCAGGCACACGTTGAAGCAAATGCAC[C/T]AAGCTGCAACAATCATTCAGTCCCATGTGAGAATGCGGATCCTTAATTTG
Long Flanking Sequence:
CTTTGATTCTGCAAGCAGCCTATCGTGGCAAGAAGACCAGACAGGCTTTGAAGCAAATGCACCAAGCTGCAACAATCATTCAGTCCCATGTGAGAATGCGGATCCTTAACTTGCGCTTCCAGCGACTTCGATGGGCAGTCTGTACTGTTCAGGAGCGTTTCAGAGCTAACAGAATCATGAGGCAGGAGATGGCAGCACTACAGGAAAAGAAAAGTGCAGCTTTGATTCTGCAAGCAGCCTATCGTGGCAAGAAGACCAGACAGGCTTTGAAGCAAATGCACCAAGCTGCAACAATCATTCAGTCCCATGTGAGAATGCGGATCCTTAACTTGCGCTTCCAGCGACTTCGATGGGCAGTCTGTACTCTTCAGCGACATTTCAGAGCTAACAAAATCATGAGGCAAGAGATGGCAGCACTACAGGAAAAGAAAAGTGCAGCTTTAATTCTGCAAGCAGCCTATCGTGGCATGAAGACCAGGCACACGTTGAAGCAAATGCAC[C/T]AAGCTGCAACAATCATTCAGTCCCATGTGAGAATGCGGATCCTTAATTTGCGCTTCCAGCGACTTCGTTGGGCAGTCTGTACTGTTCAGCAACGTTTTAGAGCTAACAGAATCATGAGGCAGGAGATGGCAGCACTACAGGAAAAGAAAAGTGCAGCTTTGATTCTGCAAGCAGCCTATCGTGGCATGAAGACCAGACAAACTTTAAAACAAATGCACCAGGCTGCCACCATTGTACAGGCAACTTACCGAGCTTATAGTGGACGTAAGCGGTATTTAGAAATGAAATGTGCTGCCATTGATATTCAGCAAAGATATCGGGCTGTAAATGCAGCAAAGCAGCAGAGAAAGAGTTATCTTAAAGTGCGTCAAGGTGCACTTGTTCTACAAGCGTGCTATAGAGGTCGTAAAGTTAGGAGGAACCTGCAACTACAGTGCCAAGCCGCTGTCTTGATTCAATCATATTTTAGAAGACACAAAGAGATGGTTAAGTACCAGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11648
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 2382 3411 19 30
ENSDART00000126795 Nonsense 2362 3391 18 29
Genomic Location (Zv9):
Chromosome 22 (position 24331110)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23541634
GRCz11 22 23568198
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCTTTGAWTCTGCAAGCAGCCTATCGTGGCATGAAGACCAGACAAACTT[T/G]AAAACAAATGCACCAGGCTGCCACCATTGTWCAGGCAACTTACCGAKCTT
Long Flanking Sequence:
AAAGAAAAGTGCAGCTTTGATTCTGCAAGCAGCCTATCGTGGCAAGAAGACCAGACAGGCTTTGAAGCAAATGCACCAAGCTGCAACAATCATTCAGTCCCATGTGAGAATGCGGATCCTTAACTTGCGCTTCCAGCGACTTCGATGGGCAGTCTGTACTCTTCAGCGACATTTCAGAGCTAACAAAATCATGAGGCAAGAGATGGCAGCACTACAGGAAAAGAAAAGTGCAGCTTTAATTCTGCAAGCAGCCTATCGTGGCATGAAGACCAGGCACACGTTGAAGCAAATGCACCAAGCTGCAACAATCATTCAGTCCCATGTGAGAATGCGGATCCTTAATTTGCGCTTCCAGCGACTTCGTTGGGCAGTCTGTACTGTTCAGCAACGTTTTAGAGCTAACAGAATCATGAGGCAGGAGATGGCAGCACTACAGGAAAAGAAAAGTGCAGCTTTGATTCTGCAAGCAGCCTATCGTGGCATGAAGACCAGACAAACTT[T/G]AAAACAAATGCACCAGGCTGCCACCATTGTACAGGCAACTTACCGAGCTTATAGTGGACGTAAGCGGTATTTAGAAATGAAATGTGCTGCCATTGATATTCAGCAAAGATATCGGGCTGTAAATGCAGCAAAGCAGCAGAGAAAGAGTTATCTTAAAGTGCGTCAAGGTGCACTTGTTCTACAAGCGTGCTATAGAGGTCGTAAAGTTAGGAGGAACCTGCAACTACAGTGCCAAGCCGCTGTCTTGATTCAATCATATTTTAGAAGACACAAAGAGATGGTTAAGTACCAGGCCATGAAGCTGTCTGCTGTCATTATCCAGAGCCATTTCAGGTCATACATCCAGGCTAGAGCAGATCGGAAGAACTATCAACATTTGAGAAAATCTGCCATAGTCATTCAAGCTGCTTTTAGAGGACACTCTCTCAGGAGACATTTAGCAAGAAAGCAAGAAGCTTCTGTTATCATACAGGCCAGCTTCCGCATGTATCAGCAAAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13529
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 2806 3411 20 30
ENSDART00000126795 Nonsense 2786 3391 19 29
Genomic Location (Zv9):
Chromosome 22 (position 24329729)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23543015
GRCz11 22 23569579
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTGGGAAGGCCAAACTTTTTTCCCCCTTGCTATCAAACAGGCAAATTAT[C/T]GAGGGATGRTTGAGAGACGCAGGTTTCACCAACTCAAGGAGTGTGCWTTG
Long Flanking Sequence:
GTTAGACAAGCTACGCTTACCTTGCAGTCTGCCTTGAGGGGAATGCTGGTGAGGAGGCTTGCAAAAAGAAGAAGGGCTGCAATAAAGATTCAGTCTGTGATGCGCATGCACATACAACGCAAGCGCTATGTAACTCTCCGTGCAAGTGCCCTGAAGTTTCAAGCTCATTACAGAATGTTAGTGGCCCAAAGAAAATACCGTCGATTGCAGGCTGCAACTGTTACTCTTCAAAAGCATTACAGATCTCATAGGGCTACATTGGAGCAGAGGTGCAGTTATCTGAAGACTCTCCAAAACATAAAAAAACTTCAGGCCAGAGTACGTGGACACATTGCGTACAAACGATTTCAGAGATTGAGAACATGTGCCATCACCATTCAGGTAATCACTATGCATTCTCTCTTGTCAACATGATTTTCTTTGGAAATTCAAAAGACGTGATTGAGCTCAATTGGGAAGGCCAAACTTTTTTCCCCCTTGCTATCAAACAGGCAAATTAT[C/T]GAGGGATGATTGAGAGACGCAGGTTTCACCAACTCAAGGAGTGTGCATTGGTTATACAGAAGCATTACAGAGCTTTCATTCTTTGCCAGAAAGAGCGTTCAAAGTTTCTTCAGCTGCGACAATCTGCTGTTGTGATACAAGTAAGATTGTGATATCTGTTTTATCTTTAGACTTTTAGTTTTCTGTTTATAACCCTATTTGAGATATTACAACTTTAACTATGTATTGAATGTTCATGTTTGGGTTGTCTTTATGTAATCTCAGAGAGCATATCGAGCTTATCAAAAAAGACAAAATGCAATGAAAGCACAGGCTGCACTGAAAATTCAGGCTTGGTTCAGAGGACGCCTTGCTAGACGCAACTACATCTTAAAACAAGCCGCTAGTGCCACCATTCGAAGATGTATCCAAGCGAGACGCCAACGCTCTAAGTAAGAAATTAAAGATATTATTTTGTTTATTCATTTTTTTGCTTTGTGTAACAAGGAGTCGCAACCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5003
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Essential Splice Site 2908 3411 21 30
ENSDART00000126795 Essential Splice Site 2888 3391 20 29
Genomic Location (Zv9):
Chromosome 22 (position 24329296)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23543448
GRCz11 22 23570012
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTAKTGCCACCATTCGAAGATGTATCCAAGCGAGACGCCAACGCTCTAAG[T/A]AAGAAATTAAAGATATTATTTTGTTTATTMATTTTTTTGCTTTGTGTAAC
Long Flanking Sequence:
AGACGTGATTGAGCTCAATTGGGAAGGCCAAACTTTTTTCCCCCTTGCTATCAAACAGGCAAATTATCGAGGGATGATTGAGAGACGCAGGTTTCACCAACTCAAGGAGTGTGCATTGGTTATACAGAAGCATTACAGAGCTTTCATTCTTTGCCAGAAAGAGCGTTCAAAGTTTCTTCAGCTGCGACAATCTGCTGTTGTGATACAAGTAAGATTGTGATATCTGTTTTATCTTTAGACTTTTAGTTTTCTGTTTATAACCCTATTTGAGATATTACAACTTTAACTATGTATTGAATGTTCATGTTTGGGTTGTCTTTATGTAATCTCAGAGAGCATATCGAGCTTATCAAAAAAGACAAAATGCAATGAAAGCACAGGCTGCACTGAAAATTCAGGCTTGGTTCAGAGGACGCCTTGCTAGACGCAACTACATCTTAAAACAAGCCGCTAGTGCCACCATTCGAAGATGTATCCAAGCGAGACGCCAACGCTCTAAG[T/A]AAGAAATTAAAGATATTATTTTGTTTATTCATTTTTTTGCTTTGTGTAACAAGGAGTCGCAACCTGACAATTTTGATTTTTAAATTTGAAGATTTCTAGCAGTCCAGCACAGTGTCCGAGTGATTCAGCAAAGATGGAGGGAAACTCTCAGCTCAAGAAAACAGCATGCTGAGTTCCTAAAGTTGATAAAGTCTGTTATATACATCCAGGCGTTGTGGAGAGGTCGGAGACTAAGGGATTCCATTCAAAAGGTAATAGTTTTTTTGTGGGAATAAATATTTATTAGATGGAAATGGGTGACTGATGTCTATAAGGGAAGTCACTTTTGTTTTATAGCTTGTTTGCACCTGGGTTTTTGATGCTTGAATTTTAAAATAGAGGGTGTGAAACATGTTGAGCTTTTCTTTTGAACGCTTCCAGAATAGGGGTTCTTCAGTTATATAGTGCATCCGGAAAGTATTCATACCGTTTCACTTTTTCCACAATTTGTTTGTTACAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6712
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 3089 3411 25 30
ENSDART00000126795 Nonsense 3069 3391 24 29
Genomic Location (Zv9):
Chromosome 22 (position 24322014)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23550730
GRCz11 22 23577294
KASP Assay ID:
554-4098.1 (used for ordering genotyping assays)
KASP Sequence:
ATTTATCTTTCTTTCCCCCRAMTTTCCAGCAATGTTTTAGGGCAAAACTG[C/T]AGAGAAAGRAATATCTRAAAGACAGAGAAGACATCATCAAGACCCAGAGA
Long Flanking Sequence:
TACCTTTAAAACCGCTGTAATAGTGCTGTGTTGCTTTCTGAAACCTGATTGAAATTTTGACATAATATTATTTATTTATTTATAATTGATTGTTTACAAGTGATTTAAGGACTTTAGCTTTTTTTTACATAAAAATTGGTGGATGTTAATAAAGCTAATGTAAGTAAATATCATTTACACTAAAATCAGGTGACACTAAAATCAGGTCTAAATAGGGTCTGAAAAGGTTTTAACTTATGAAAACTTAAAAAAAAAAAAATCTCAGATACTGGTTTTAAAAACAATACCATTTTAAGCAATCTAATTGTTGTTTTAGTTGCATCATAGTTTTGCTACATAATTGCAATGACTTTGCTAGCCAAAGGTACCATTGTGCATGCGTAACAGAAGTATTGAGCATTAGCTTATTTTAAATTTTGCTCATGATGAACACTTTTAATGTAAATGTGCATTTATCTTTCTTTCCCCCAACTTTCCAGCAATGTTTTAGGGCAAAACTG[C/T]AGAGAAAGAAATATCTAAAAGACAGAGAAGACATCATCAAGACCCAGAGAGCAGTGAGATCTTGGTTACATCGCCGCAACCAGGCTGCCTCTATTATCCAGCACGCAGTCAGGAAGCTGCTTTTTAGACGTCGCAAGGAGAGGCTACAACGTGGTATAATAAGGGCACAGGTATGGCATAAGGGGAAAAAAAAACTGATTATTCTAAATGGAAAGTGCTATTTAATATGGAAAAATTTGTATGCTTTGACATGTTAAATCCTTTATTATTTTTCATTTAAATTTGCAAGTTTTCTCAAACTCTTATTTTTTTATTTTCAATCTTGGCCTTTTCCATACAATTATTTTATTTTGTATGAACAGCTCACAAAAATGCATACACATTTTTAATACCAGGAAAGCATCCACTAGAATGTTCTTTCTGTCAATAGCTTGTCGCCAAAGCATTTTTTTCATTGTATTGTCTTGGCTTTAAAATGATAGTTAACTTTAAGTTACTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37516
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 3111 3411 25 30
ENSDART00000126795 Nonsense 3091 3391 24 29
Genomic Location (Zv9):
Chromosome 22 (position 24321947)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23550797
GRCz11 22 23577361
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAAGACAGAGAAGACATCATCAAGACCCAGAGAGCAGTGAGATCTTGGT[T/A]ACATCGCCGCAACCAGGCTGCCTCTATTATCCAGCACGCAGTCAGGAAGC
Long Flanking Sequence:
TTATTTATTTATTTATAATTGATTGTTTACAAGTGATTTAAGGACTTTAGCTTTTTTTTACATAAAAATTGGTGGATGTTAATAAAGCTAATGTAAGTAAATATCATTTACACTAAAATCAGGTGACACTAAAATCAGGTCTAAATAGGGTCTGAAAAGGTTTTAACTTATGAAAACTTAAAAAAAAAAAAATCTCAGATACTGGTTTTAAAAACAATACCATTTTAAGCAATCTAATTGTTGTTTTAGTTGCATCATAGTTTTGCTACATAATTGCAATGACTTTGCTAGCCAAAGGTACCATTGTGCATGCGTAACAGAAGTATTGAGCATTAGCTTATTTTAAATTTTGCTCATGATGAACACTTTTAATGTAAATGTGCATTTATCTTTCTTTCCCCCAACTTTCCAGCAATGTTTTAGGGCAAAACTGCAGAGAAAGAAATATCTAAAAGACAGAGAAGACATCATCAAGACCCAGAGAGCAGTGAGATCTTGGT[T/A]ACATCGCCGCAACCAGGCTGCCTCTATTATCCAGCACGCAGTCAGGAAGCTGCTTTTTAGACGTCGCAAGGAGAGGCTACAACGTGGTATAATAAGGGCACAGGTATGGCATAAGGGGAAAAAAAAACTGATTATTCTAAATGGAAAGTGCTATTTAATATGGAAAAATTTGTATGCTTTGACATGTTAAATCCTTTATTATTTTTCATTTAAATTTGCAAGTTTTCTCAAACTCTTATTTTTTTATTTTCAATCTTGGCCTTTTCCATACAATTATTTTATTTTGTATGAACAGCTCACAAAAATGCATACACATTTTTAATACCAGGAAAGCATCCACTAGAATGTTCTTTCTGTCAATAGCTTGTCGCCAAAGCATTTTTTTCATTGTATTGTCTTGGCTTTAAAATGATAGTTAACTTTAAGTTACTTTTTTCTTTAGAACATGACATATTTTGAAGAAAGCTGAAAACCTGTAACCACAGACTTCCACAGCGTTT
Associated Phenotype:
Not determined