Busch Lab

ZMP

ap3d1

Ensembl ID:
ENSDARG00000071424
ZFIN ID:
ZDB-GENE-050208-437
Description:
AP-3 complex subunit delta-1 [Source:RefSeq peptide;Acc:NP_001038480]
Human Orthologue:
AP3D1
Human Description:
adaptor-related protein complex 3, delta 1 subunit [Source:HGNC Symbol;Acc:568]
Mouse Orthologue:
Ap3d1
Mouse Description:
adaptor-related protein complex 3, delta 1 subunit Gene [Source:MGI Symbol;Acc:MGI:107734]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa24163 Essential Splice Site Available for shipment Available now
sa8748 Nonsense Mutation detected in F1 DNA Not yet available
sa43834 Nonsense Mutation detected in F1 DNA Not yet available
sa10591 Nonsense Available for shipment Available now
sa25180 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa24163
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105580 Essential Splice Site 64 1247 2 33
Genomic Location (Zv9):
Chromosome 22 (position 22581268)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 22192904
GRCz11 22 22217882
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAGGACAACATCGCCGTTAAAGCCAACGCCGTCTGCAAGCTCACCTACG[T/A]AAGGCTGACAGTCGCATCATTCAGATTTCTTTTTTCTTTTGAGCTCAAGC
Long Flanking Sequence:
AATGCATACTGAATAATAAATGTAAAAAAATTCCCATAAACTTTCATTACAGAGCAGCTTGGACATTCTGCTAAATATCTTTTGTTCGTTTTAAAAGGAAAAATATTGATTTACTATAAAATAATATAAACCTATATCTTTTATATATGCTAATTATGCTAGATGCTGACATCATCGTCAAAATATTGTCTTGATGAATCTGCGTATCAATGTGAGATGTAGCAAAATCTGGCTCTGCTGAAGTGTTAATTGCCACACATCGTTTCTCGTTAAGCTCAGGCGGTGAATTGACAAATGCGTCTGACAACAGGAACTAAATAATGCGTCGGGCTGTTATGGAGAGCATTGTCTCTCTGTATTTTTGGCTCACTCTTTCTAACAATACTTCCTGTTCCCTCTACAGGCCAAATACATCTCTACCTGCATCGATGAGATCAAACAAGAACTCAAACAGGACAACATCGCCGTTAAAGCCAACGCCGTCTGCAAGCTCACCTACG[T/A]AAGGCTGACAGTCGCATCATTCAGATTTCTTTTTTCTTTTGAGCTCAAGCCGTCACTTATTTGCTTTGTGTTCTGCTTCTAACAGTTGCAGATGCTCGGCTATGATGTGAGCTGGGCTGCTTTCAACATTGTGGAGGTCATGAGCTCCTCCAAATTCACTTATAAGGTGAGAGGAGGCGTCAGAATCAATGTTTTATATGTCTGTATGTGTGTGTTTTGGTGTTATTTATATACTAGTTTAAGATTTATTCATATTTTTTTTAATTTAGTTTTGTTTTTGTCATTTTTTAAAAATATATTTTTTTACGTTTTTATTGATTTAATTTTTACACATTTGTACTTTTTTTTTTTTTTTTTTTTGTATTTTACTTTTTGTTTTTATTTTAAATTAGTTATAATCAGGGCTTGACATTAATACCTGCCAAATGCAGGTAGATTTCAGGGTTAGGCAGACAATCCTACTAGCCACTCTGGCTGATGGAAAACAATTTTTAAGTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8748
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105580 Nonsense 90 1247 3 33
Genomic Location (Zv9):
Chromosome 22 (position 22581105)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 22192741
GRCz11 22 22217719
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGGCTGCTTTCAACATTGTGGAGGTCATGAGCTCCTCCAAATTCACTTA[T/A]AAGGTGAGAGGAGGCGTCAGAATCAWTGTTTTATATGTCTGTATGTGTGT
Long Flanking Sequence:
TGCTGACATCATCGTCAAAATATTGTCTTGATGAATCTGCGTATCAATGTGAGATGTAGCAAAATCTGGCTCTGCTGAAGTGTTAATTGCCACACATCGTTTCTCGTTAAGCTCAGGCGGTGAATTGACAAATGCGTCTGACAACAGGAACTAAATAATGCGTCGGGCTGTTATGGAGAGCATTGTCTCTCTGTATTTTTGGCTCACTCTTTCTAACAATACTTCCTGTTCCCTCTACAGGCCAAATACATCTCTACCTGCATCGATGAGATCAAACAAGAACTCAAACAGGACAACATCGCCGTTAAAGCCAACGCCGTCTGCAAGCTCACCTACGTAAGGCTGACAGTCGCATCATTCAGATTTCTTTTTTCTTTTGAGCTCAAGCCGTCACTTATTTGCTTTGTGTTCTGCTTCTAACAGTTGCAGATGCTCGGCTATGATGTGAGCTGGGCTGCTTTCAACATTGTGGAGGTCATGAGCTCCTCCAAATTCACTTA[T/A]AAGGTGAGAGGAGGCGTCAGAATCAATGTTTTATATGTCTGTATGTGTGTGTTTTGGTGTTATTTATATACTAGTTTAAGATTTATTCATATTTTTTTTAATTTAGTTTTGTTTTTGTCATTTTTTAAAAATATATTTTTTTACGTTTTTATTGATTTAATTTTTACACATTTGTACTTTTTTTTTTTTTTTTTTTTGTATTTTACTTTTTGTTTTTATTTTAAATTAGTTATAATCAGGGCTTGACATTAATACCTGCCAAATGCAGGTAGATTTCAGGGTTAGGCAGACAATCCTACTAGCCACTCTGGCTGATGGAAAACAATTTTTAAGTTGTAGTTTTTTTGTTTGTTTGTTTTTTTATAAGCAGGGTTCGACTGTAAGGATAGACCAATATTTGTGCAAATGTGATCTTAGAGTGCTTTCACACGTAGACTTTTGTTTTGGAACCTGTCTCGTTTGCCCAATTAGCGTGGTTTGTTTGGCATATGTGAAACCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43834
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105580 Nonsense 302 1247 10 33
Genomic Location (Zv9):
Chromosome 22 (position 22575115)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 22186751
GRCz11 22 22211729
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTGCTGATCTCGCTGTCTTCTGGGATGCCCAATCACAGTGCAAGCATA[C/T]AGGTGGGCTTTTGGCACATTACTTGGTGTAACCGGCTGATTTATTTTAAT
Long Flanking Sequence:
TCTTTAGAATTGTATCAAATATGATCCAGTAGGCTTTAAATGTGTTATTCTGACCCTCAATATCCACTTTCTCTCAGATTTTAACTTCAATTTTCATGAAAGTTGTCTAAAATGAACCTTTTTTTCCATTTCTTTAATCATATGTTCATCTTTCAGTTTGGTGCTCTCACTCCTTTGGAGCCTCGTTTGGGAAAGAAGCTGATTGAGCCCCTGACAAACCTCATCCACAGGTAATGGTGATGCTAAAACACCAACACTGACAGGAATATTAGGGTTAAATATAATATATGTCTTTCATTTTATTCACTCTCTCAGTACCTCGGCCATGTCGCTTCTCTATGAGTGCGTCAACACAGTTATAGCAGGTCAGTATTTCTGGTGCCGTGACCCGGTGTTGTATTCACTTTTTAGAACATTGGCACTGATGTCTGTTCTCTCTCCTGTTTTACTCAGTGCTGATCTCGCTGTCTTCTGGGATGCCCAATCACAGTGCAAGCATA[C/T]AGGTGGGCTTTTGGCACATTACTTGGTGTAACCGGCTGATTTATTTTAATGTTTTTTGAGGCCCTTTTTATATACATTTATAATGTAGCATTGATATATAAAGGTCATGAGTATTTTTTTTAATCTTTAAACGTTATAATGATCAGCCAGGTCGTTACTTTGTTGCTTTTATATGTGTAGAATAGGGCTGTGCGATTTGGGGAAAATATCTAATTGCAATTGTTATTTATTTATTTGTTTTTAACAGATATTTGCGATTTCGATTTGATTTGCGATTTAATTTTGTAGTCCAGCTTCAGCTCAATATTCTGTATCTTAGCTTCTTACTGCTAAAAGTGAGTGTTAGTTAATAAAGGAACTGAAAAGATATTAACTTACTCCAACTTTTATTCAAATTAGTTTAAAAATATTCAGAAATTAAACACTAATTTTCTCTGGAGTAATTTATCACGTTAGTTGCCTTCGTGATGTTTTATCATGTGGTGTAAAAGCTGTAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10591
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105580 Nonsense 309 1247 11 33
Genomic Location (Zv9):
Chromosome 22 (position 22573246)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 22184882
GRCz11 22 22209860
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGTTTTCCWTTTCTCTCTCTCTCGTCSACAGCTCTGTGTGCAGAAACTG[C/T]GAATCCTRATTGAAGACTCGGACCAGAACTGTGAGCCTTCTGTCAATGCC
Long Flanking Sequence:
AAAGCATCAGCTTTAGAATGAATACAAGTTATTAAATAGACCATTATGAAGGATGTAAACAAAAAACAAGGGTCCCAACGTATTTCCTGTTTTACAATTTTAATTTCTATAGCTTCCGACAATCCAAAAAGAGACGCATACTGATGAATAATGTTATTATAGCTGTTTTAAACATTACGTTATGATTGAATTGCCTCTTGTTACAGTTATGAAATAATTTGAAAACTAGCAGGAAATGTTCTTGTGCCAATGACATGACCACATTGAAATTGTCTATATTTTGTCCTTCTTGGTGTAGAAATCATCATTTAGTCAAGTTTCATTTAAAGATAAGTGCCAAACAGAATCATTGGCTTAAAAAAACACCTGACCCATCTAATGACGTCACACATTGCTGTAAGATGCTGTGAAAAGGATTTAAACATTAGTAGTAATTCCTTTCGTCTCCTTCTGTTTTCCTTTTCTCTCTCTCTCGTCCACAGCTCTGTGTGCAGAAACTG[C/T]GAATCCTGATTGAAGACTCGGACCAGAACTGTGAGCCTTCTGTCAATGCCTGCAGTGTGTCATTCTCTCATTGTCTGCATGTTTCTGAGTCCCCCTTCTGGTCCTGTAGATGGAGTCCATGTAGACCTCCATCCCGGATAACTCGAAGACAACCTCAGTGCTACAACAGAGAATTGGCAAGCGTCATTTGTAGCTTTTATAGCTTGAGGAACTTCTCAAAAAAGTGTCCTCCAAAAGAGCCATGCACATTAAACAATCTTGAATTACCTGTCAGGAGTTCGAGTTATCGGTGTCCCTATGAAGCTGGCTATAGAGTAGCTCTACGAATCCTGGACTACCATGTTTTGTTTTTCAGAAACCACAGAGTCGCCTTAATATTAACTTGCATTTGAATGGCCAAGACTTATTGAGTCTTATTGAGTCTGCCAAGTCTTATTTCTATAGATCAGTGTATTTGTATATTGGCATCAGGAAAAGCCCAGTGTTTTAATGGCCCAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25180
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105580 Essential Splice Site 715 1247 19 33
Genomic Location (Zv9):
Chromosome 22 (position 22559953)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 22171589
GRCz11 22 22196567
KASP Assay ID:
554-7713.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACACATCCCAGTGGTGCAGATTGACCTTAGTGTGCCTCTCAAAGTCCCAG[G/T]TGAGCAAAGTGATCTAGTAAAATCCTCCATAAGGGAACGTAGAATAAAAA
Long Flanking Sequence:
GGTTCCTAGCACAACATGTAAGCAACACATCAGCAGTGTGTTCAATATTAGCATTGTTTGAAATTGGAACATTAGCATTTCCTGAAAAGTTCTATAAACATGCAAATGTGTTCAATCATGCTAACGTGATAAATGGGCAATCTAGCTAGCAAAAAGACTGCATGGGAACATATTAAAAATAATAAAAACAGTATACTGACAATAAGTGAATTATTGCCAGCAACATGGTAACAAAACCCATTATGTTTAGACTTGCTAAAAGCGTTTTCATGTTAGCAGTGAGATAAGGCTTGCTAGCAACATTGTGCTAATTTGTTAGCATTTTAATAACCAAAAATGTTAAGAAAATAAATAAATCTACATTTTGTCAATATTTGACACTCTTATTTCTAAGACTACAAAACATTGACATTTGATCTTGTTGCAGGTTTATGATGCGCCAGGAGTTGAACACATCCCAGTGGTGCAGATTGACCTTAGTGTGCCTCTCAAAGTCCCAG[G/T]TGAGCAAAGTGATCTAGTAAAATCCTCCATAAGGGAACGTAGAATAAAAATAATCAACATCATCATAATTGTGTTGCGTTTATTCCAGGGATGCCCATGTCTGACCAGTACGTCAAGCTGGAGGAGGAGCGCCGGCAGAAGGAGAAGGCCGACAAGAAGAAGAAGGAGAAGAAGAAAAAGAGGGAAAAGCGAGGGAAAGGGAGGAAGGGGGATTCAGGTCCCGAGAGCGAGGAGGACATCACACCTGCTCACCATGTGGACATAGTCACAGAGGAAATGCCAGAGGTAGACAGCTCTTATTTTACACGCATTTTACCCTCATGCTGCATACAGCTCCATTTTGATGTGGAAGAGTTATAGCACACAAAATGTATGTGTTTAGTGAGAAAACAAAACTATGCAAATGCTTTAATGGCCCGTTTCCACTGACTGGTACAGTACAGTATGGGTCGCTACGGGTCACCTTTATCAAGCTTGCATTTTCACTACCAAGGGTACCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29774
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105580 Essential Splice Site 1091 1247 28 33
Genomic Location (Zv9):
Chromosome 22 (position 22540155)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 22151791
GRCz11 22 22176769
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAGCAGGACCCCACGACGGCCTCACCGTCCCCTTCCAGTTGCCGCCAGG[T/G]CACTGCAGTCCTCATTTTCTTTGACCAGTCATATCAATTTGGCCAATTTT
Long Flanking Sequence:
CACATATAGATCCACACATCATTTTAAAGAAACTGTATTTGCATCCCTCAGTCTTGTGTTTGCTTATGTCAGATTACACACTATGGCGTCTACTGTGACTAATATCTGTTGAGTGCTGAAAGAGATCTGGCTTAAACTCTACTTGTTCAAAACACTTGTAAAGCTGATGATGATGAAACTCTCGGGTCTGTTTTCCTCTTCGCCGTCTTTTCCTTCTGTTCTCGGTCAGCCGTGTGGTGTTGCTGTGATCTCCACAAATTACCCTATTCATCCGTTTCTGACTCATGAAAGTGTTTCTCTCTTCTGCAGGTCTGTGACATTCAGGGCAACCATCAGGACGAGAGTAAAGTGGTGGTGTCGGTCATCTTCGAGAACAAGAGCGACAGCTTTCTTAAGTCCATGGAGTTCAATGTGCTGGATTCGCTCAACTCCAAACTGCAGCGGCCGGACGGAGCAGGACCCCACGACGGCCTCACCGTCCCCTTCCAGTTGCCGCCAGG[T/G]CACTGCAGTCCTCATTTTCTTTGACCAGTCATATCAATTTGGCCAATTTTTTTGTCAACAATGTTTTAGTGACAGAATAGACACAACAATTAAAAACTATTAATAAGGAAAGTGTTCTAAATGACAAACTATAACAAAAAGTTTAATAAATAATGCAATAAATTAAACAATATAATGAAAAGTTAAAAACCCTGCTATTCCTTGAATTAAATTTTAAAAGACCTGAAACAAAAACTATTCATTTTAAGTTCGTTTTGGCAGTTAAAAGCAAAAAAAAATATATATTTTTTTTCTTAAACATTTTTAAGCTACCATTGGTCCGTGATGATTAGGCAGTCGGTGGCTGTCTCCTGGAACTCTGCCTTTAACATGCTTCATATTGGGTCAGGAGAAAAAGATCCAGCACAAGAACACCAAATTAGCAACAAGAATAAACTGGAGGGTTGATCCAGAGCTGATATAGATTTACGATTGCTCGCGGAATCCACATTGCAGAATCA
Associated Phenotype:
Not determined