Busch Lab

ZMP

si:ch211-207c7.1

Ensembl ID:
ENSDARG00000071416
ZFIN ID:
ZDB-GENE-050208-781
Description:
hypothetical protein LOC562625 [Source:RefSeq peptide;Acc:NP_001038454]
Human Orthologue:
GNA15
Human Description:
guanine nucleotide binding protein (G protein), alpha 15 (Gq class) [Source:HGNC Symbol;Acc:4383]
Mouse Orthologue:
Gna15
Mouse Description:
guanine nucleotide binding protein, alpha 15 Gene [Source:MGI Symbol;Acc:MGI:95770]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa37509 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3195
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105570 None None 107 None 2
ENSDART00000143075 Nonsense 167 361 4 7
Genomic Location (Zv9):
Chromosome 22 (position 22274367)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 21927615
GRCz11 22 21952593
KASP Assay ID:
554-3425.1 (used for ordering genotyping assays)
KASP Sequence:
TTGTTTTCYAACTTATAAGTACATCAAATTTGTTTTATAGCTTTGTTGAT[C/T]GACTGGACCAGATCACAGCCAATAACTACATCCCCACAATACAAGATATT
Long Flanking Sequence:
TTTTTTTTGCCAAAATCTGGTTCAATTCCATGTCAACAGCTCCTTTAAAAAATTTGCCCTAGGAAAAAAAAACTATATACATATATGCTTAAACCAGTTTAAGAAAGATTGTATCTTGTATTGTTGTGTACTGTCAGTCTCCTTACTTCTGTAATGTTCATAGATTTACGCTCAGTGGTTCCAGAATCAAGACTCACATCAGATAACAAAGTTGCTGAGTTTTGTAGAGCCCATTCGTCATCTATGGGCAGATGAAGGCTTTAAGAACTGCTTCAAACTCTGCAAAAAGAATCACAGACACTTGACTAGTCTAGAATAGTAAGTTTGTTTAACAATTCTCTTCAATAATGTCTTTTCCTGACGTTGCTTAATGAATGCAGTCAACAATGCCACCAAAAACATTTAGCACACAGAATGGTTTTCAGTTACAGACAGTGATGAAATTTGTTGTTGTTTTCCAACTTATAAGTACATCAAATTTGTTTTATAGCTTTGTTGAT[C/T]GACTGGACCAGATCACAGCCAATAACTACATCCCCACAATACAAGATATTCTCCGTGTCCAATCGTCCACCAATGCCATTGCAGAGCTGTCCATTCCTATGCAAATTTTCACGTTTAGGTATGTACGATTTGCCACTACTTAAAGTTTGCATGAAATTAAAATATACAATGTTTATTTAGCTATTTTTCAAATTGTTATTCTTAAGGTGAACAGTGGATCTCTGCAAGTTAATCCACTCAAAAAAAAGTTTGTTTTGGTAATCTTCAATCAATAAAGTCTGACCGCTGGCTTCCACATTCCTATTCTGTTGACGTCAACCTGAGGGCTTCTATAGCAATTTTATAGATTATTATTCATAACCAAATCCCACATTTTTTTATTTAACGTCTGATTTAGACATCGTGGCTTGTTTTTTGTTGTTGTTTTTTTTGTATGTTGCTATGTAACCCCCAGTTTGTAAAAAATATTAAATTGTTCAAAAGCAATACGCATTTTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37509
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105570 Nonsense 19 107 1 2
ENSDART00000143075 Nonsense 213 361 5 7
Genomic Location (Zv9):
Chromosome 22 (position 22275469)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 21928717
GRCz11 22 21953695
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATTACCTAATTTTATGTTTTATTTTTTTAGGTTTATCAATGTCGGTGGT[C/T]AGAGAGGACAAAGGAGGAAATGGATCCATCACTTTGAAAATGTGACAACT
Long Flanking Sequence:
CAGGTAACAGGTGTTGCTAGACGGAAGGGAGCAAATACAGTTTTGACTACACACGCATTCACACACACACACTCACACACTCATACACATTCATTCACGCTTTAGCGTGACGGTTTGTTTTGTTGGCTTGTAAGTCACGATATGTGGCAGTGTTTGATGTTTACGAACGGAAACTTACCTGGAAGGAAACTTGTGAACTACTGGAGTTTGCAACTACAACAAACCTAAATATCCAAGGAGACAAGTAAGACTGTTCATTGCGTTTACACTTCATCAGCCAGAGGACAGTGTGAGTCAGCTGGGTGCCTGTCTAACAACATCTCAGGGACTTCAAGCAATAGGCTTAGCCTCTACAGGCCCTATCCAATATTCTGTTTCAATTGGAAGTACATTGACATAATAAAAGTTATGGCAACTTCAAACTCACGCATACTCAGCACAGAAGTATGAGATTACCTAATTTTATGTTTTATTTTTTTAGGTTTATCAATGTCGGTGGT[C/T]AGAGAGGACAAAGGAGGAAATGGATCCATCACTTTGAAAATGTGACAACTGTCATATTTGTAGCTTCTCTCAGCGAGTACGATGAGTTTCTGGAGGAGAATAACAAGGTTTCTGGCTGTCTTCTTTCCGTAAAAATCTCTTTTAAGTAAAATCATCAACCCAGGCTCATACTGAAAACGTACCTCTATATACATTTCTGGAGAGTGCCAAATACGTCCCTGGAGGCATGTTTTTTTTTTTTTTTGCAGTTTTTGGTTTTGCAAATCCACCAGAGGCTAATGTGAATGCTTTTGAGATCTAAAATTTCTCTCGTGAGTGTCATTTGCGCCTGCTATTCTCACGGAAATCCCCCATATTCACCAAACTGACTGGCTGACTGACCGACTGAACAATACTCCCACCACCATCACCACCTTCCATAAACCCAACCAATAATGTTTTTAAAAGAAATCCAGTAAAAGAAAAGCCCTTGCCTGAGTTTTAACATGTTTTCATATTTT
Associated Phenotype:
Not determined