Busch Lab

ZMP

si:dkey-78l4.6

Ensembl ID:
ENSDARG00000071389
ZFIN ID:
ZDB-GENE-060503-83
Description:
Novel protein containing a trypsin domain [Source:UniProtKB/TrEMBL;Acc:Q1LUL4]
Human Orthologue:
GZMM
Human Description:
granzyme M (lymphocyte met-ase 1) [Source:HGNC Symbol;Acc:4712]
Mouse Orthologue:
Gzmm
Mouse Description:
granzyme M (lymphocyte met-ase 1) Gene [Source:MGI Symbol;Acc:MGI:99549]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa17890 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17890
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105511 Nonsense 83 251 3 5
ENSDART00000141371 Nonsense 89 257 3 5
Genomic Location (Zv9):
Chromosome 22 (position 19772619)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 19429312
GRCz11 22 19454290
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCTTTCATCAGGAATCAGGATTTGACTGTTGTGGTCGGTGCCCATGATT[T/A]GAGAAAACGTMAAMATTCCAAGAACTTTATAGTGAAGARCCACATTACGC
Associated Phenotype:
Not determined