Busch Lab

ZMP

si:ch211-197g15.10

Ensembl ID:
ENSDARG00000071361
ZFIN ID:
ZDB-GENE-050208-617
Description:
hypothetical protein LOC555357 [Source:RefSeq peptide;Acc:NP_001122156]
Human Orthologues:
IFI44, IFI44L
Human Descriptions:
interferon-induced protein 44 [Source:HGNC Symbol;Acc:16938]
interferon-induced protein 44-like [Source:HGNC Symbol;Acc:17817]
Mouse Orthologues:
H28, Ifi44
Mouse Descriptions:
histocompatibility 28 Gene [Source:MGI Symbol;Acc:MGI:95975]
interferon-induced protein 44 Gene [Source:MGI Symbol;Acc:MGI:2443016]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa37487 Nonsense Mutation detected in F1 DNA Not yet available
sa43808 Nonsense Mutation detected in F1 DNA Not yet available
sa29754 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa37487
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105458 Nonsense 181 483 2 8
ENSDART00000105459 Nonsense 167 469 4 10
ENSDART00000142267 Nonsense 190 492 2 8
Genomic Location (Zv9):
Chromosome 22 (position 17681649)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17432584
GRCz11 22 17457562
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGACTGTTTGGAAATGTTAGCGCAATGAATGCATTCAATTTTAATTCTT[C/A]AACACTATATGGAAACGACTGTGCCCTGACTGAATGTGAGGTGTACAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43808
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105458 Nonsense 233 483 4 8
ENSDART00000105459 Nonsense 219 469 6 10
ENSDART00000142267 Nonsense 242 492 4 8
Genomic Location (Zv9):
Chromosome 22 (position 17681306)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17432241
GRCz11 22 17457219
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGATCTGTCACAGACAAAAAGCAGAGCTCATGGAAATGATCAGGAATTAT[A/T]AACCCCTGACATCTTCTGTCAGCCATATTCGAATCCTGATGATTGGTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29754
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105458 Essential Splice Site 336 483 5 8
ENSDART00000105459 Essential Splice Site 322 469 7 10
ENSDART00000142267 Essential Splice Site 345 492 5 8
Genomic Location (Zv9):
Chromosome 22 (position 17680924)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17431859
GRCz11 22 17456837
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGAGGACATCAGCAGCATTCTTCAAGGACAAATACCAGACCGCTATAAA[G/A]TAAGAGCACTTACTGAATCTCCAAAATGAATGAAGACTGAAGTGTGAATG
Associated Phenotype:
Not determined