Busch Lab

ZMP

utrn

Ensembl ID:
ENSDARG00000071274
ZFIN ID:
ZDB-GENE-070228-6
Description:
Utrophin isoform G [Source:UniProtKB/TrEMBL;Acc:A2CKC9]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa918 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa918
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105287 None None 154 None 3
ENSDART00000131381 Essential Splice Site 227 250 6 6
ENSDART00000134991 None None 148 None 3
ENSDART00000145543 None None 291 None 6
Genomic Location (Zv9):
Chromosome 23 (position 1248986)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1227425
GRCz11 23 1236532
KASP Assay ID:
554-0824.1 (used for ordering genotyping assays)
KASP Sequence:
ACTGANTTTTAGTGGACGTCAGTATGAATGYGTGTTTGGGTGTGTTTTTC[A/T]GCTGTTGAGGCGAGAYGAGTGTGTGAGTGAAGGACAGGAGAAAGTGTCGA
Long Flanking Sequence:
TTATTAATGACCACAGAGAGTCAGGACCTCTGTTTAACGTCTCATCCGAAAGACGGCGCACACTGACAGTGTAGTGTCCCCTTCACTATACTGGGGCATTAGGACTCACACAGACCACAGGTTGAGCGCCCCCTGCTGGCCTCACTAACACCACTTCCAACAGCAACCTAGTGTTCCTTAGTGGTCTCCCATCCAGGTACTGACCAGGCTCAGCCCTGCTTAGCTTCAGTGAGTAACCGGTCTTAGGCTGCAGGGTGATATGGCTGTGATAATGTCTCTGGATGTGCCAGCGAAATGTGCACCAACAATATGTCCTGATATGCCACCCATAATGTTGTGTGCGTTGCAATATTTCAAGCAAAACTGTGCTGTTGCTCTGCTAATTAAACCTTCACACTCTGCTCTTACTGCTGGATTCAAGAGCAATGAAGATCAGCCACACAATATTCCACTGATTTTTAGTGGACGTCAGTATGAATGTGTGTTTGGGTGTGTTTTTC[A/T]GCTGTTGAGGCGAGACGAGTGTGTGAGTGAAGGACAGGAGAAAGTGTCGAATCTGAAGAAGGACGTGGCGGAGATGCGGGAGTGGATGATTCAAGTGGACGAGGAGTTTCTGATGAGAGACTTTGAGTACAAGAGCCCTGAGGAGCTGGAGGAGGCCCTGCAGGAGATGAAGGTGCTTCATGACTACACATCTCTCACAGTTAAAGGGATAGTTCACCCAAACATCAAACATCTCTAGTTTTACTTAATGCGGAAAAGCTGTAACCATTGACTTCCATTGTAGAAAAAAACAAATACAATGGAAGTCAATGGTTACAGGTTTTCAGCACTCTTCAAGATATCTTAATTTGTGTTCAGCAGAAGACAGAAATAGTGAATATGTTTTTATTTTTGGGTGAACTATCCCTTTAACGTTAATTAATAATGTTATACACTCTGTTAACATGTTAGAAAAATATTAGATTTTAGATGTGTTTTTATGTTGTTATTTTTTTTCTTTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa836
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105287 Nonsense 10 154 1 3
ENSDART00000131381 None None 250 None 6
ENSDART00000134991 None None 148 None 3
ENSDART00000145543 None None 291 None 6
Genomic Location (Zv9):
Chromosome 23 (position 1300391)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1278830
GRCz11 23 1287937
KASP Assay ID:
554-0739.1 (used for ordering genotyping assays)
KASP Sequence:
ACGAATGTGTGTGTGTGTGTGCGGTGAGGATGCGTGCTCTCAGACGCTGG[C/T]AGTCGTGTGCAGGCAGAGTTAGGATGATGGCTGTAGTTCGGACGTCTCTG
Long Flanking Sequence:
TTCCCATCGTCTCTCTTTCTCTCTTTCGTTTTTTTTTCCCTCCAAAGCGTCTCACTGCTCTATTTCTCCGTCTCTCCAGAGATGTGCTCTCTTTCAGCAAAGTGTGTCACCCTCACTCATTCCCTTTATGAATTTTCACGCACAGACACACACTCATTCTTACGGTGCTAAAAGATGCGCTCCGTCTCCTGAACGCTCTCCAGAGTTTCTCTCTGTCCGCTATATCAACCCTCCTCCTCCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCAAAGCATCATTCTCTCCCTCGTTCATTCTCCTTTTTCCTCGTCCTGTATTAAATCTCAGCGTGACTCTTGTTTATCGCAGGAGAGGAGCGCAGATATTGCTGACGCTCTTTAGTGTGTGTGTTTTTGTGACATGGCTCGTCACATTTGGCTGGTGGTGGGGAGTATGTGAGCGTGCGTGAACGAATGTGTGTGTGTGTGTGCGGTGAGGATGCGTGCTCTCAGACGCTGG[C/T]AGTCGTGTGCAGGCAGAGTTAGGATGATGGCTGTAGTTCGGACGTCTCTGCAGAAAGTGGTGGTCTTTTTACACCGGCTCCAGAGAATGGCGATTTCTTCACCGCGGTACCAGAAACTGTGCAAGGTTAGTAATCTCTGATGCACTTGCTGTCTTTTGCCGGACTGTAGCCGGACTTTGCATAAGAGATAGGCTTTATTGGGAGTACTTATGAAGTTGAACAGTCGCATGGAGTTTTAGTGCCGTATATGTTCTTTCAGAAAATGTGAGTGTTTGGTTTTAGTGCATTTATTAAAGCTCAAGTTTGTCATTTGTGCAGATGTGGTCTGTTCTTTATACCGAATGGCAATACTGGGAACTCATACAAGCCATGTGCTTTATTTTGATCAGCTTTGCTGTCAATTCTGCCACATGTTCAGACATACAGAAGATTGAAAGTATGTTACTGTTAATCCTTCATTGCATACATATAACAAAAACACTAGAAGAGGAATAGTTTGG
Associated Phenotype:
Not determined