Busch Lab

ZMP

slc12a10.2

Ensembl ID:
ENSDARG00000071173
ZFIN ID:
ZDB-GENE-060503-425
Description:
solute carrier family 12 (sodium/potassium/chloride transporters), member 10.2 [Source:RefSeq pepti
Human Orthologue:
SLC12A3
Human Description:
solute carrier family 12 (sodium/chloride transporters), member 3 [Source:HGNC Symbol;Acc:10912]
Mouse Orthologue:
Slc12a3
Mouse Description:
solute carrier family 12, member 3 Gene [Source:MGI Symbol;Acc:MGI:108114]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa20849 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20849
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042061 Nonsense 423 998 11 26
Genomic Location (Zv9):
Chromosome 7 (position 4528641)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 4218954
GRCz11 7 4356980
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACTAACTACTTATTTATTTGTATCAGATTCTTACCGTTGTGTCAGGATG[G/A]GGCATTCTGATCACTATTGGGACCTTTGCTGCAACCTTGTCATCAGCGCT
Associated Phenotype:
Not determined