Busch Lab

ZMP

ENSDARG00000071165

Ensembl ID:
ENSDARG00000071165
Human Orthologue:
VCL
Human Description:
vinculin [Source:HGNC Symbol;Acc:12665]
Mouse Orthologues:
Gm14025, Vcl
Mouse Descriptions:
predicted gene 14025 Gene [Source:MGI Symbol;Acc:MGI:3649276]
vinculin Gene [Source:MGI Symbol;Acc:MGI:98927]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa42301 Nonsense Mutation detected in F1 DNA Not yet available
sa35590 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa22380 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa42301
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105018 Nonsense 346 652 1 7
Genomic Location (Zv9):
Chromosome 13 (position 48828668)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 47560069
GRCz11 13 47851309
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGAGTTCAAGTGAAGCTTTGGAAAAACTAAAAGAAGTCCATCAGAGATG[G/A]TCAGAGGAGATAGAGCAACTTTTGCATGCTTGTGGCAGCATAATAAACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35590
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105018 Essential Splice Site 513 652 4 7
Genomic Location (Zv9):
Chromosome 13 (position 48826793)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 47558194
GRCz11 13 47849434
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAGACTGTTTCAACTTCATTCGAGACCCAAAGGAGAGGTCCAATCTGAG[G/A]TTTATTAATGACCACCTGACTTTTCAAATGTCAGACATTGTGAGTAGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22380
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105018 Essential Splice Site 513 652 4 7
Genomic Location (Zv9):
Chromosome 13 (position 48826792)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 47558193
GRCz11 13 47849433
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGACTGTTTCAACTTCATTCGAGACCCAAAGGAGAGGTCCAATCTGAGG[T/C]TTATTAATGACCACCTGACTTTTCAAATGTCAGACATTGTGAGTAGAGCC
Associated Phenotype:
Not determined