Busch Lab

ZMP

si:ch211-39e15.1

Ensembl ID:
ENSDARG00000071150
ZFIN ID:
ZDB-GENE-060503-700
Description:
Novel protein similar to vertebrate capicua homolog (Drosophila) (CIC) [Source:UniProtKB/TrEMBL;Acc:
Human Orthologue:
CIC
Human Description:
capicua homolog (Drosophila) [Source:HGNC Symbol;Acc:14214]
Mouse Orthologue:
Cic
Mouse Description:
capicua homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1918972]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa12496 Nonsense Available for shipment Available now
sa43212 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa1539 Nonsense F2 line generated Not yet available
sa45654 Nonsense Mutation detected in F1 DNA Not yet available
sa39226 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa13191 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12496
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104978 Nonsense 295 2440 1 19
ENSDART00000140051 None None 1323 None 18
Genomic Location (Zv9):
Chromosome 19 (position 6749981)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 6208656
GRCz11 19 6127687
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGAATCAGAGAGTTTTGGCCCGACAGGGTCCTAGATTAGGRGAAGGCTG[G/A]CCTCATGATCGTGGCCGGGATGTATCAGGAGTGTTTCGCACTGGTGTCRT
Long Flanking Sequence:
GCCCGTGTGCCCAAGAAGAAGTACACCTTCGAGCACTGTGCCGGAAACCATGGCAACGCTAGCACTCCCAGCACACCCCCACAGAGCAGCAGCAGCTCTCACAATGGTACTGGTACTAGCCAGGTCCCAGCTGCCTCTGCTGCACATACAGACCCAGACGGTCAAAGCCAGCAAGCTGAAGGCAACATTGCAATGTATGCACACAATAACATAACAGGGCCCACGGGAAGAACTGCTAGTGATTGTGGTGAAAGGGACAGGACAAGTGTATCCAGCCCACAGCGTTGCTCCTCCACAGATACGGCCAGCGAACACTCGGCTGACATAGAAGTGACAACTTCTGGACATGATTCTAGCGCTAACTCCCAAAAGCCACAAGCACATAGCACTTCAATACCCACACAGGAGAGCCTGTCATCTGGGTTAGCTGGAGTCCTGGCCAAAGGTCTTAAGAATCAGAGAGTTTTGGCCCGACAGGGTCCTAGATTAGGAGAAGGCTG[G/A]CCTCATGATCGTGGCCGGGATGTATCAGGAGTGTTTCGCACTGGTGTCGTACGGAGAGTTAGCGAGGAGCATGGGAGTTTGGAGGTGCAGCTGAACGGAGAAAAGACCATTTGCAAGTACCCTTTTCGAGTGGCTTCTGATTCTGTTGATCTTATTCTAGATGCGTCACCTCCTGGTGTGGCCCCAGTGGCAATAGGCACCCGTGTTTGCATCCCCTTTAAAGGGGACGATGAGGGGAGTGAGGGAACACGTCAGTGGTACAGAGAAGGTGTAGTTACTCAAGTAGACCAACATCCAGCTGTGTCTTGTCAATATCGCGTCCAGCTACGGGAGGATGTATCTGATGAGAGAAAGGAAATTAGAAGTGAAGAGGACGATGGAAGGGCCATAAGTGCTCAAGCCATTTGGGTCTCACGACAAAACCTTCGCCTCCTAGTTCCTCCTTGGGACCTAGAACCACCCCAGGCAGCAGAGCCAGAGGGTGATGGTAGGAGGGTTAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7875
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104978 Nonsense 547 2440 1 19
ENSDART00000140051 None None 1323 None 18
Genomic Location (Zv9):
Chromosome 19 (position 6749227)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 6207902
GRCz11 19 6126933
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGAAGAATCAGGAAAGAGATTTGCATAGGCACTTAGAGAGAGAAAGGGAA[C/T]GAGACCGAGATGACATTGAGGTCAGTCGTCTCAGTCAGCTAAGGGATGGC
Long Flanking Sequence:
AGTGGTACAGAGAAGGTGTAGTTACTCAAGTAGACCAACATCCAGCTGTGTCTTGTCAATATCGCGTCCAGCTACGGGAGGATGTATCTGATGAGAGAAAGGAAATTAGAAGTGAAGAGGACGATGGAAGGGCCATAAGTGCTCAAGCCATTTGGGTCTCACGACAAAACCTTCGCCTCCTAGTTCCTCCTTGGGACCTAGAACCACCCCAGGCAGCAGAGCCAGAGGGTGATGGTAGGAGGGTTAGAGAACGAGAGTGGGAGGAAAGAGATGACATGGAAGTTGAGCAGGAAGTTGTTCGGCTGACCAGGCCAGGGTATAAAGTGCCGAGTTTGTTACATCCTGTGATAGTTCCTTACACCTCACCACATACTTCGTCTTCTGCCATTAACACTGCCATCACGTCTGTACTCAGTGTAGTCCCAAACAGAGACTGGGAACATCACAGAGAGAAGAATCAGGAAAGAGATTTGCATAGGCACTTAGAGAGAGAAAGGGAA[C/T]GAGACCGAGATGACATTGAGGTCAGTCGTCTCAGTCAGCTAAGGGATGGCAGCATCACTGCAGCCATGGATGGCAAAGCTCAAGGGGTTCCTTCTCAGAATCGACCCATTCTTTCTAAACCAAACTACCTCAGCCATCCCCTGCTGAGAGGGCCCCCAATTGCACCCCACCTACCCCTTGCTCCTCATCCAAATCATCCCCATATGCTTCTGGGCCTGGATTCAGCCACAGGTGCTGCAGTCATCTCCACACCCCAGCTTCCTCCTTTGCCCCCAAGCTCATCTCGAAGCTCCCTTGACAAAACCCCCAGCTCCAGCTCACATGGAGTGTCAGGGGGTGGATCTGGATCCTCATCCTCTTCGTCACGTTCTCGCACACCCCTCACAGCTGCTCAACAGAAGTACAAGAAGGGCGATGTGGTGTGCACCCCTACAGGTATCCGCAAGAAGTTCAATGGCAAACAGTGGCGCAGATTGTGCTCACGTGAAGGCTGTTCAAAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29148
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104978 Essential Splice Site 1213 2440 2 19
ENSDART00000140051 Essential Splice Site 44 1323 1 18
Genomic Location (Zv9):
Chromosome 19 (position 6746262)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 6204937
GRCz11 19 6123968
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATGTCCACGCAGCCTGCAGATGGCCAAACACTTGTAAATCAGAGCAAAG[G/A]TAACAATCAATGAAAAAAAAAAAAAAATGAAATTAGCATTTTAAACTGCA
Long Flanking Sequence:
TGACTTTGGTATGCTGGTCAGCAGCAGGTGTGTTTGGGTGTGTGTAGTGAAGAATGCACTGTGCTTTCGGGTCAGTGCCTCTTTAGACAGTTGCAGCATGTCTGAAATGATACACAGGAACTTGCCCAGACATGCACAGCTAGAGAGTGATTAGGCCGCCCTGATTCTCATGAGTATTTAATCTGAGATGCACAGTTCACTGACATGTTACGCTAGTCACTGATACACAGACATATGAATGGGTTCATTCAGCTTTAGTCTAACATTTTAGACTAACACTTTAGTCTAAATTTTTTTTTAAAGCACTGCAAGTTTTCTTAAATCCGTCATGCGTAAATGTGAAAGTTTTTGTCTGTTTCTGCATTTAGTTTGGACCAATGTGGAGCCCCGCTCTGTGCCAGTGTTTGCATGGCATTCATTGGTTCCTTTTCTGGAAACCAGCCAAACTAAAATGTCCACGCAGCCTGCAGATGGCCAAACACTTGTAAATCAGAGCAAAG[G/A]TAACAATCAATGAAAAAAAAAAAAAAATGAAATTAGCATTTTAAACTGCAACATATTCTTTAATGACACAAAATGGCATTTAGAATACTTGAGCTGATGTTTTGGAACCGAATGAACTTGCAGAGCCTCGTTGTGGAGTAGCCCTTGTGTCTGAGGGGCTGACTGACCATCCAACACCAGAGAGAGGCTCCCCGTCTTGCCCCCCTCCTTCAGCTGAAGACCCACCCGTGGAGAGAGAAGGAGGCGACAGCGAGACTGAGAGTGACGCTGACGACCTGTAAATATCTGCTTGCATCTCACTTATTGAGCAGGGGGTCATGGAGGGATGGGTGAGGAAGGCATGAAAAAAACAAAACATTTAGATGACAATATCTTAATCTTTTTTGCTCACAAACAGAACTGATCACAATAGTAGTATATGTAATATACAGTTGAAGTCAGAATTATTAGCCCCCTGATTATTCTTTTCCTTAATTCCTGTTTAATGAAGAGAAGTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43212
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104978 Essential Splice Site 1360 2440 6 19
ENSDART00000140051 Essential Splice Site 191 1323 5 18
Genomic Location (Zv9):
Chromosome 19 (position 6739199)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 6197874
GRCz11 19 6116905
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTTTCATCGCATAACTCTATCATTAACCATTAAATTTCACACTCTTGT[A/G]GGTGAAGGAGGCTCATTTCCGGGCTCACCCTGATTGGAAATGGTGTAACA
Long Flanking Sequence:
TTTTAAACATTTCCAGAAAATATGTGAATAATTAGCTTCATTTGAGCCAGATAATCTCATGCAGACTACCTTTTTGTTTAAGTATCTCTTTTGCTTAGGGGTGACGAAAATACGAATGATGTTTTTCCAACCAAATTCCTTCCAGACCGAGGAGGATGTTGATTTCCACTGTGTTTTAAAAATTATTTTCCATTCTTCCTCAGTAATTTCAAGTATTGCACTCTTACTGTGATTGTTTTTCATTGACTAGATCGCATTTTTAAATGATCAGTCCAGTAGGTGGCGCTGATTAACATCGGTATAAGTTTAAAGACATAAAAAGTAAACTATTCTTAAAACTATCATTTCAAAGCTGTCTGAATGTGACTGTTTACATGCATCAGCTGCTGACCTGATGTTCGAAGCATCCTGTTTGCACATACAGGCAAAGCATAATGGGTGATTTGTGTATGTTTTCATCGCATAACTCTATCATTAACCATTAAATTTCACACTCTTGT[A/G]GGTGAAGGAGGCTCATTTCCGGGCTCACCCTGATTGGAAATGGTGTAACAAGGACCGAAGGAAGTCCCTGTCTGAGGGCCGGGGAACTCCAGGGGCCAAAGATGCTCGCGAGCGCAGCGTGTCTGAAAGCACAGGTCCGTGTGGGTGTTTGTTTACATGAGTGGGTGTTTGTTGGTCTTGTGAAACTATGAGTGTATATAGTAGTGTGAAATGTAACTGATGGCGAATTATTAACTTTCTCTGTTTCCCCAGAGCCCCATTCAACGTCTCAGGGTGCAGAACACAAAGGGGCAGGGCCCAGCTGGACTTCACCTCCATCTGACTGTCACGGACGATCACCAGCAGGACAGCTTCAGCGGCCTCGTGCTTTTTCCCAGAGCGCCGTGCACACTTTGGAGAGGAGGGAGAAGGAGAGAGAGCTGGACAGTGGGAGTTTGTTTCAGGCCCGTCCTCTTACTCGCCCGCGCCGCCCCAGTGAGGATGTGACCAGTGATGAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1539
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104978 Nonsense 1378 2440 6 19
ENSDART00000140051 Nonsense 209 1323 5 18
Genomic Location (Zv9):
Chromosome 19 (position 6739143)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 6197818
GRCz11 19 6116849
KASP Assay ID:
554-1462.1 (used for ordering genotyping assays)
KASP Sequence:
AGGAGGCTCATTTCCGGGCTCACCCTGATTGGAAATGGTGTAACAAGGAC[C/T]GAAGGAAGTCCCTGTCTGAGGGCCGGGGAACTCCAGGGGCCAAAGATGCT
Long Flanking Sequence:
TCATGCAGACTACCTTTTTGTTTAAGTATCTCTTTTGCTTAGGGGTGACGAAAATACGAATGATGTTTTTCCAACCAAATTCCTTCCAGACCGAGGAGGATGTTGATTTCCACTGTGTTTTAAAAATTATTTTCCATTCTTCCTCAGTAATTTCAAGTATTGCACTCTTACTGTGATTGTTTTTCATTGACTAGATCGCATTTTTAAATGATCAGTCCAGTAGGTGGCGCTGATTAACATCGGTATAAGTTTAAAGACATAAAAAGTAAACTATTCTTAAAACTATCATTTCAAAGCTGTCTGAATGTGACTGTTTACATGCATCAGCTGCTGACCTGATGTTCGAAGCATCCTGTTTGCACATACAGGCAAAGCATAATGGGTGATTTGTGTATGTTTTCATCGCATAACTCTATCATTAACCATTAAATTTCACACTCTTGTAGGTGAAGGAGGCTCATTTCCGGGCTCACCCTGATTGGAAATGGTGTAACAAGGAC[C/T]GAAGGAAGTCCCTGTCTGAGGGCCGGGGAACTCCAGGGGCCAAAGATGCTCGCGAGCGCAGCGTGTCTGAAAGCACAGGTCCGTGTGGGTGTTTGTTTACATGAGTGGGTGTTTGTTGGTCTTGTGAAACTATGAGTGTATATAGTAGTGTGAAATGTAACTGATGGCGAATTATTAACTTTCTCTGTTTCCCCAGAGCCCCATTCAACGTCTCAGGGTGCAGAACACAAAGGGGCAGGGCCCAGCTGGACTTCACCTCCATCTGACTGTCACGGACGATCACCAGCAGGACAGCTTCAGCGGCCTCGTGCTTTTTCCCAGAGCGCCGTGCACACTTTGGAGAGGAGGGAGAAGGAGAGAGAGCTGGACAGTGGGAGTTTGTTTCAGGCCCGTCCTCTTACTCGCCCGCGCCGCCCCAGTGAGGATGTGACCAGTGATGAAGAGCACATGGTGATCTGTGAGGAGGGGGATGATGATGTCATAGGTAAGTTATGTGCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45654
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104978 None None 2440 None 19
ENSDART00000140051 Nonsense 693 1323 9 18
Genomic Location (Zv9):
Chromosome 19 (position 6727859)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 6186534
GRCz11 19 6105565
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATTAGGCAGTTAGTTCATCAAGTCTATTCTCGGTCTGCGCTATATCAGT[G/A]GTGTTCATCTCTCTGCTCAGTTCAAGCGCAGTCCCCTGTCCTGCAGAGCA
Long Flanking Sequence:
TGGTTAATATAACGCCATGTTTTCTAGTCTTCAATAGACATGTTTAAATATTATTAAATAAATTAGAAAATGACCCATGCCAGCTATATTTACCTTGCCTCAATCCAGTTTGGTTTTTGGCCCTTCATATGAAAATGTTTGGGCAGCCCTGCTTTAATAGCTTTGAGTTCAACAAGGCAAAACCTCTGGGTGTGAATCACCACGATTGAAATTTGAGCAGCTTTTTGAGTAAACGAATCCCAATATTTGAGTGAATTCTTTTCAATGATTCAGTCAAGTCAGTTCAAAAAATGACTCATTTATGAACAAGCCACTGAAATTCATTTCAAAACATGTGGGAACCCTGTAGTGTCCACATTCTTTAGCACGTTTGCATTCACGCCTTTTGAAGGGATTTAATGTGGTTTCTCGCTCTCACACCGAGCGGGATTCTGCAGACAGTGTTTGGCAAATTAGGCAGTTAGTTCATCAAGTCTATTCTCGGTCTGCGCTATATCAGT[G/A]GTGTTCATCTCTCTGCTCAGTTCAAGCGCAGTCCCCTGTCCTGCAGAGCAAGATGCTGGTTCCCATGGCAACTGTCGGAACAGGATCTACACCTCCGCAGCCAATTTCCCTGGTGGGCCCGCCTCTTCCTGTTCAAAACGGTGCTCCAGGAAGTAAGGTACGTTGCCTAGTGTTACTATCTAACTCTATTAACAACACCTATACAGTTAAAGTCAAAATTATTATTGTTTTTCAAATATTTTCCATTTGATGTTTAACAGAGCAAGAAATTTTGCACAATATTTGCGATAATATTTTTTCTTTTAGAGAAAGTCTTATTTGTTTTATTTTGGCTAGAATAAAAGCAGTTTTTTAACCATTAAAAATTTAACGTATGTAGATTTTAAACTGTTTTAAATCATAAAAATACCATAAAATGTTTGCAGATATTTCATAAACATGTTAAGTGAACATTTTCGTTTATCTGAAAAACAATGTTAAAGTCAGATATTCTGCTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39226
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104978 Essential Splice Site 1862 2440 10 19
ENSDART00000140051 Essential Splice Site 745 1323 9 18
Genomic Location (Zv9):
Chromosome 19 (position 6727701)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 6186376
GRCz11 19 6105407
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCTGGTGGGCCCGCCTCTTCCTGTTCAAAACGGTGCTCCAGGAAGTAAG[G/T]TACGTTGCCTAGTGTTACTATCTAACTCTATTAACAACACCTATACAGTT
Long Flanking Sequence:
AGCTTTGAGTTCAACAAGGCAAAACCTCTGGGTGTGAATCACCACGATTGAAATTTGAGCAGCTTTTTGAGTAAACGAATCCCAATATTTGAGTGAATTCTTTTCAATGATTCAGTCAAGTCAGTTCAAAAAATGACTCATTTATGAACAAGCCACTGAAATTCATTTCAAAACATGTGGGAACCCTGTAGTGTCCACATTCTTTAGCACGTTTGCATTCACGCCTTTTGAAGGGATTTAATGTGGTTTCTCGCTCTCACACCGAGCGGGATTCTGCAGACAGTGTTTGGCAAATTAGGCAGTTAGTTCATCAAGTCTATTCTCGGTCTGCGCTATATCAGTGGTGTTCATCTCTCTGCTCAGTTCAAGCGCAGTCCCCTGTCCTGCAGAGCAAGATGCTGGTTCCCATGGCAACTGTCGGAACAGGATCTACACCTCCGCAGCCAATTTCCCTGGTGGGCCCGCCTCTTCCTGTTCAAAACGGTGCTCCAGGAAGTAAG[G/T]TACGTTGCCTAGTGTTACTATCTAACTCTATTAACAACACCTATACAGTTAAAGTCAAAATTATTATTGTTTTTCAAATATTTTCCATTTGATGTTTAACAGAGCAAGAAATTTTGCACAATATTTGCGATAATATTTTTTCTTTTAGAGAAAGTCTTATTTGTTTTATTTTGGCTAGAATAAAAGCAGTTTTTTAACCATTAAAAATTTAACGTATGTAGATTTTAAACTGTTTTAAATCATAAAAATACCATAAAATGTTTGCAGATATTTCATAAACATGTTAAGTGAACATTTTCGTTTATCTGAAAAACAATGTTAAAGTCAGATATTCTGCTTTGAAAATGTGCATGTAGCGCATGTATATATAAAAATATATATAGGGGGGCTAATAAATCAGGAGGGCTAATTATTCCGAGTTCTCACTGCATGTATTGTATTTAAAACAGTCTGATTTGTACTCTTCTCAGATCATCCAGATCGCCCCAATGCCTGTGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13191
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104978 Essential Splice Site 2311 2440 18 19
ENSDART00000140051 Essential Splice Site 1194 1323 17 18
Genomic Location (Zv9):
Chromosome 19 (position 6712819)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 6171494
GRCz11 19 6090525
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TATTAACCCATACATGAACATRAATGCATTTGRGTCTTCTGTGTTCATCA[G/A]TTGGAGAGACCGAGCATATTTTRGAAGAGCTGGAYCGCGTGCCGCCSTCC
Long Flanking Sequence:
TCTTTTTTTTTTTTCTCTCTTGTTTTACCTGGGAGTTTCCCGTATTTCAGACCCGTCACCCTCCCGTTTTGTTATTTATCCCAGGAAAACTCCAGTAATTTCAACCATGAAAACCCATAATTATAGCTCTTTAAAAAAGAAAAAAAATAATAGCAGGGCACATAATTGTGACTTATATTATATATAACTGTATATCACACACATTTATAATTTATTTTGGTTGCGATTAACCACGATTAATCTTTTCCCAACACTAAATATCATCTTTTTTTTTTTCTCCATCCTGCAGATCTAGACTCCACCGATGACCCCACTTCACCGAGAAGGAAGAGTCGTCGTCTGTCAAGCTGCAGCTCCGAGCCCAACACACCCAAGAGTGCTGCCAAGTGCGAAGGGGACATCTTCACCTTCGATAGAACTGGTAGGTTCATTTTTATATGAACGCAACTTTATTAACCCATACATGAACATAAATGCATTTGGGTCTTCTGTGTTCATCA[G/A]TTGGAGAGACCGAGCATATTTTAGAAGAGCTGGATCGCGTGCCGCCGTCCTCTCTGCGTCGGATGCTGGATCAGCGGCGTGCTCTCGTCATGCAGCTCTTCCAGGAGCACGGCTTCTTCCCCTCAGGTAAAATCAAGATACTCCTCTTCCAGTATAGAATAGTGTTGTACTGATACTGGAATTCAATGCCAATCGATATTGAAATTTTCAAAACGTCCATTTCCTGCTAACATTTGAGCGGCATTCTTATAGCCCGTTTCCACTGAGTGGCACAGTACGGTACAGGTCACCTTTATCAGGCTGGCATTTCCACTGCTAAAAGGGTACCAATAGTGGGCGTGGTGTACGACAAAGTTTCAGTCAACGTCAGTCAAAAAACAGATGCTTTATACACATAAATACTTGCGTATAAATGTTCATCACTAACCTTACTTTGAACAAAATGTATTATAACTGCAGATCAATACTATAAAATGAAATAGCCTACTGTAACATCTGTG
Associated Phenotype:
Not determined