Busch Lab

ZMP

actn2

Ensembl ID:
ENSDARG00000071090
ZFIN ID:
ZDB-GENE-051127-39
Description:
alpha-actinin-2 [Source:RefSeq peptide;Acc:NP_001032662]
Human Orthologue:
ACTN2
Human Description:
actinin, alpha 2 [Source:HGNC Symbol;Acc:164]
Mouse Orthologue:
Actn2
Mouse Description:
actinin alpha 2 Gene [Source:MGI Symbol;Acc:MGI:109192]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa42906 Nonsense Mutation detected in F1 DNA Not yet available
sa274 Nonsense, Stop Lost Confirmed mutation in F2 line Not yet available
sa36380 Nonsense Available for shipment Available now
sa36379 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7828
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104882 Nonsense 43 895 1 21
ENSDART00000133327 Nonsense 42 126 1 16
ENSDART00000138911 Nonsense 42 894 1 21
Genomic Location (Zv9):
Chromosome 17 (position 19973791)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 20123802
GRCz11 17 20143638
KASP Assay ID:
2261-0883.1 (used for ordering genotyping assays)
KASP Sequence:
AATGGGACCGGGATTTACTGCTGGATCCWGCATGGGAAAAGCAACAAAGG[A/T]AGGTAAAGAGAGTTTGGCCTTCACTGAATAAAAACTTTAYTTCTATTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42906
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104882 Nonsense 213 895 7 21
ENSDART00000133327 None None 126 None 16
ENSDART00000138911 Nonsense 212 894 7 21
Genomic Location (Zv9):
Chromosome 17 (position 19964856)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 20114867
GRCz11 17 20134703
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACACTGTGCCCGTTCCTCTCCTTTCCTGTAGGATGATCCACTGGGTAATT[T/A]AAATCTGGCATTTGACATTGCTGAAAAACATCTGGACATCCCCAAAATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa274
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense, Stop Lost
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104882 Nonsense 287 895 9 21
ENSDART00000133327 Stop Lost 127 126 4 16
ENSDART00000138911 Nonsense 286 894 9 21
Genomic Location (Zv9):
Chromosome 17 (position 19963205)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 20113216
GRCz11 17 20133052
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTAAGGTGCTTGGAGTGAATCAGGAAAATGAGAAGTTGATGGAGGATTA[T/A]GAAAGGCTGGCTAGTGAGGTGAGAAGACACATTGTAGTCTAATACATATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36380
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104882 Nonsense 681 895 17 21
ENSDART00000133327 None None 126 12 16
ENSDART00000138911 Nonsense 680 894 17 21
Genomic Location (Zv9):
Chromosome 17 (position 19957340)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 20107351
GRCz11 17 20127187
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTCTATGGCGATGGGCGGAACTCTGGAGGATCAGATGACCCAACTGAAG[C/T]AGTATGAGCATGTGATCGTCAGCTACAAATCCAACATAGACCGACTTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36379
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104882 Nonsense 682 895 17 21
ENSDART00000133327 None None 126 12 16
ENSDART00000138911 Nonsense 681 894 17 21
Genomic Location (Zv9):
Chromosome 17 (position 19957335)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 20107346
GRCz11 17 20127182
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGGCGATGGGCGGAACTCTGGAGGATCAGATGACCCAACTGAAGCAGTA[T/A]GAGCATGTGATCGTCAGCTACAAATCCAACATAGACCGACTTGAGGGAGA
Associated Phenotype:
Not determined