Busch Lab

ZMP

zgc:162420

Ensembl ID:
ENSDARG00000071062
ZFIN IDs:
ZDB-GENE-070410-80, ZDB-GENE-070410-80
Description:
Hermansky-Pudlak syndrome 5 [Source:RefSeq peptide;Acc:NP_001083008]
Human Orthologue:
HPS5
Human Description:
Hermansky-Pudlak syndrome 5 [Source:HGNC Symbol;Acc:17022]
Mouse Orthologue:
Hps5
Mouse Description:
Hermansky-Pudlak syndrome 5 homolog (human) Gene [Source:MGI Symbol;Acc:MGI:2180307]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa24589 Essential Splice Site Available for shipment Available now
sa37981 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa24589
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104832 None None 187 None 13
ENSDART00000104835 Essential Splice Site 199 1174 5 23
Genomic Location (Zv9):
Chromosome 25 (position 3150112)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 3057671
GRCz11 25 3183415
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGTGGGAAGGTGTCCTGCGTCCGGGCTGGGTCATCTAAACTCGGCAAGG[T/A]ACAAAAAGTCATGTAGATGATACAATTACAAACTTGGGGTTGTTGGATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37981
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104832 None None 187 6 13
ENSDART00000104835 Nonsense 810 1174 16 23
Genomic Location (Zv9):
Chromosome 25 (position 3127878)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 3035437
GRCz11 25 3161181
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGAGGGATGGAAAGCGTGTGTGTGTTCCTGAGGAGGTTCTTCTTCCTGT[T/A]GGACCAGGAAAGAGTGAGGAGGATGTGTATGCTGAGGTACAGGGAGAACC
Associated Phenotype:
Not determined