Busch Lab

ZMP

arl6ip6

Ensembl ID:
ENSDARG00000071013
ZFIN ID:
ZDB-GENE-070410-117
Description:
ADP-ribosylation-like factor 6 interacting protein 6 [Source:RefSeq peptide;Acc:NP_001082970]
Human Orthologue:
ARL6IP6
Human Description:
ADP-ribosylation-like factor 6 interacting protein 6 [Source:HGNC Symbol;Acc:24048]
Mouse Orthologue:
Arl6ip6
Mouse Description:
ADP-ribosylation factor-like 6 interacting protein 6 Gene [Source:MGI Symbol;Acc:MGI:1929507]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa14400 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14400
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Founder:
SL4_06_F12
KASP Assay Location:
Unknown
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104732 Nonsense 111 159 2 4
ENSDART00000110669 Nonsense 111 188 2 4
ENSDART00000125271 Nonsense 111 159 2 4
Genomic Location (Zv9):
Chromosome 6 (position 13285128)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 13141618
GRCz11 6 13375153
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTATAGATTTAAAAACAGAGAAGATAACCACTGAAGATGGATCAGAARTG[C/T]GACTCCTAGGTTGGTCCAGCATAAACCTAAAADTTTGCTATATAYGATAT
Long Flanking Sequence:
GTGCTGTGCAGCATAATCTTCGTATCGTTTATCGCAGTGTTGATCGCATTTCTTTACATCATTTTAAAAGGTAAACACAACTATATCTGTTTAATGCTATGATTCTCTTAAAGGGGCAGTTACCCAAAAATGAAAGTTCTGTAAACATTTAGTTTACCTTCACATGTTTTTTTTTCTTCTGTTGAACAATAAAGGACGATATACCAAATAATGTTGGGTGAAAAACACCTGTATTGACTTCTATATTATTTTTGTTCCTAGTGTGGATGTCAGTGGCTGTTTTTTTTCCAACTTTCTTCAGAATATCTTGTTTTCTGATCAACAAAAGAATTTTTTTTTATTAAAGTTAATGGTGAGGACTTTTTGGGGGTATACTGCTCCTTTAAATTTCCAGCCAGTGCAATGTTATATTTGTTACTGTATGCACAATTTGATTAATAATTCTCTTGATTATAGATTTAAAAACAGAGAAGATAACCACTGAAGATGGATCAGAAGTG[C/T]GACTCCTAGGTTGGTCCAGCATAAACCTAAAAGTTTGCTATATACGATATTAAATGGATGTTTTTAAACATGGCTTATTTTTTTTACAGGTTTTTGGAGTATTTTGGTCCTGTCTTCTATGGCTGGAGTTTTGTGTTGCAGTTTCTCCTGGACTCTAACTTACTTTGACTCCTTTGAGCCAGGAATGTTTCCTCCAACTCCTCTTTCTTCATCCAGATACAAGTGAGCATGTTTTATTATTTTTTTTCTTTAATCCTTACTCTAAAATTAAATCACCAAACCATACTATCTAAATCATGTTTGACTATAGTCATGACTATAGTCTTCTGCGAATTAGAACCCAGCCTTTTAATTATTATTATTTAATTATATATTTTTAAACCAAGTTTACATATTTTATCATTTGATCAGTTAGCAGGCTTACATTCATTACGTATGCATAAATTAAATAAAAATGAAATTAACAGCATTATTAAACATATGTCATCAAAATAAGGTCA
Associated Phenotype:
Not determined