Busch Lab

ZMP

ENSDARG00000071009

Ensembl ID:
ENSDARG00000071009
Human Orthologue:
KIF20B
Human Description:
kinesin family member 20B [Source:HGNC Symbol;Acc:7212]
Mouse Orthologue:
Kif20b
Mouse Description:
kinesin family member 20B Gene [Source:MGI Symbol;Acc:MGI:2444576]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa36402 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa5901 Nonsense Mutation detected in F1 DNA Not yet available
sa972 Nonsense Available for shipment Available now
sa28850 Nonsense Mutation detected in F1 DNA Not yet available
sa32150 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36402
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104718 Essential Splice Site 64 1683 2 33
Genomic Location (Zv9):
Chromosome 17 (position 23301778)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23451927
GRCz11 17 23471951
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGGATAAGACCATTTTCAGCAGTTGAGATTGAGAATGGAGAATCACAGG[T/C]TAAAGATATATTCATATTTATTTATTTTTGCAGTGTATTGCACAACTTTC
Long Flanking Sequence:
GGCTTTTTTTCTCCCTATACAGTTTCATGACATCTTATTTGTTTATGCGTTGTTTCAGATCAAGATGATGGAGTCAGGGCTAAAGGATGATCCAGCAAGACCTGCTATATTAGTTGTAGAAGATCTAAGGAGAAATTTGTCCACAGAGTTTGATTGTTCAGATTTGCAGGTAAGATGGCAAATTTAGGTAAATTTGGTTTTATATTCGCACATTTGGAATTTCTTCTTAAGAATTAAATTTCATAAATTTATTCTTACAATGAAATACTTATAATGTTGTTTTGAAGTCATTCTTGTATTATATAAGTATTAATAAGTGAGTGTTTATTCAATCATTATGTTTTTGAGTACCCACTATGTATGCTTTTGTTATTTTTGATGAAATGTTTGAGCTGTAATGTTACTTTTTAAGGACTCGTCAGACTTGAAGGAACATCTGAAGGTGTATCTTAGGATAAGACCATTTTCAGCAGTTGAGATTGAGAATGGAGAATCACAGG[T/C]TAAAGATATATTCATATTTATTTATTTTTGCAGTGTATTGCACAACTTTCCAGTGCCCACTCTTTTTGAGAAGAAATGTTTTTTTAAGCTTGGGGAGACATTTTTCCTGAAAAACTGTTGTTAATATTTCAAATGTATCTGTTTCTTCTCTCTGTTTTTGAAGGACTGTGTGACCATTCAGCGTCCAGACACTGTCCTTCTCAAACCTCCACAAACATCTCTGTCTGCCAGGCTCAGTGATAAATCAGTGCCAGTTACAGCTCAGCGTTTCCAGTTCTCTCAGGCAAGCAGACGCATCAACACAGTCCTCCTAAATAATAATCGCTGAAACAAGCCAATATCTTTGTTAAATCTTAAATATTGTGGTATTTTTAGGTCTATGGTCCAGACACTACACAGAAGGATATATTTGATGGCACAGTAAACGGACTTGTCAGAAATGTTCTAGAAGGGCAAAATTCTCTGGTCTTTACGTATGGTGTCACCAATGCTGGGAAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5901
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104718 Nonsense 420 1683 11 33
Genomic Location (Zv9):
Chromosome 17 (position 23305849)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23455998
GRCz11 17 23476022
KASP Assay ID:
554-3912.1 (used for ordering genotyping assays)
KASP Sequence:
TGTCCTTTCAGACAGCATGTTCCGTTCAGAGAGAGTAAACTCACTCACTA[T/A]CTGCAGGRCTACTTCACAGGCCGGGGCTCAGCCTGTATGATTGTAAAYAT
Long Flanking Sequence:
GCAACTTCCTGTTGTTCATCCATTTTTGCATAGTGGGCCCATTTGCACCTGATTTCATGTCCATATCTACTTTGTTTGATTTCTTTTCTTAGCCACAGTATTTTCTCTGTTCGAATACTGAAGGTGGAGGATGTGGGAATACCTAGAGTGGAGTCAGTCAGCGAGTGAGTGTCTATCTCTGCATGGTGTTTGGGTTGTGCCTAATGGTTTGTAAAGTAAATATTCTCCTTCCAGGCTGGCACTGTGTGATCTGGCTGGATCAGAGCGTTGTGCTAAGACTCAAAATAAAGGTGAACGGCTAAAAGAGGCTGGCAACATCAATACTTCTCTGCTCAGTCTTGGAAAGTGCATTAATGCACTAAGGAATAACCAACAGGCTAGGTATACAAATTTTCTTTTTTTTTCTTTTCTTTTTCCTCCTCTGTCTTTTAATCATTCTTTTTTTATGTGTGTCCTTTCAGACAGCATGTTCCGTTCAGAGAGAGTAAACTCACTCACTA[T/A]CTGCAGGGCTACTTCACAGGCCGGGGCTCAGCCTGTATGATTGTAAACATTAATCAGTGCTCCTCCATGTATGATGAGACGCTGAATGTGCTCAAGTTCTCTGCCGTGGCTCAGAAGGTTTGTGACACCCTATTAGGTTTTGATCTCTCTCGTTTAAGTTCTGTCATCAGTTATTCAGCCGTGTGACTTTTCATCTGTGGCTTTAGGGCACCTGAGATCTATTTAATAGAAACAGAATTTATTTTCATTTGCATTTATTTATTTATTTATTTATTTATTTATTTTCTACAAACAACTCTTAATCAAAATTATTTACACAGATCCATGTAAAACACAAAAAATGCTGTATTATGCATTCCAGAAAGGAGGTGATCTCATTACTGACATGTCAATTAATGTAACCTCATTTTAATAATTTATCATTTTTGATATGTAAAATGAAAAATGAGATTTTGAGACATCAATTGTAAAAATAAAAGCTTTAAATAATTTGAGAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa972
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104718 Nonsense 813 1683 19 33
Genomic Location (Zv9):
Chromosome 17 (position 23312895)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23463044
GRCz11 17 23483068
KASP Assay ID:
554-0877.1 (used for ordering genotyping assays)
KASP Sequence:
TACAYACCTTATAAAGTTTTCTCAATTCTTTGTAGRCCCCCCGGAGGACT[T/A]GAAAATGCCTRAAGATGAAGCAGATGATGGGCGGGAAGACTCCGCCCTTC
Long Flanking Sequence:
TACTGTTTTTATGAGCTCGACTGAATAAAGTATTTTTATTTTGCACATGGAGAACATTGCACAAACTTAAAAGCACTGTAGGTCATATAAGAACATGCAGTGTCAAGGATGCTTCTATTTCCTCTCAAAAAGAGAGGAATGTTTCTCATGATATCAAAGTGTCCCAGACACACATGAGGTGCTTCCTGAGAATAAACAGGAAGCTTTCAGACTGAGTGCTTCCAATTCTCTTTTATCTTCAGATTGAACATTTATTTTACTGCCCGATGTGCAAGTAGTGCACTCTAGATGAAATTAATTACTGGCTTTGTTGCCAGACCAATAGTAGTAAATATGCTTGGTTGTACTAAGCTAATCTGAATGTCAATATGAATTTGTTAAATGATCTATTTTGAGACCATACACAGTAAAATTGCATGCCACAGACACATCAAAACCAATATAAATATATACATACCTTATAAAGTTTTCTCAATTCTTTGTAGGCCCCCCGGAGGACT[T/A]GAAAATGCCTGAAGATGAAGCAGATGATGGGCGGGAAGACTCCGCCCTTCATGAGGTCAAAGGTCAGCTGGAGTGTTGCCTTGCTGAAGCCAAACAAAAAGACAAGCAGATCACAGACCTTGAGCAGGAATGCCACAGATTACAAGTGTGCATTCAGGATCAAAAGTCAAATCTGGATGAAAGAGTGTCACAGGAACATATTCTGAAAGAAGACGTTTGTCAGACAACATTGGAAAGCAAACAGATGGCAACGGCTGTGGATTTTAGCAATCTGAACGTAGCAGTTGCATCCAGATGTAGCAACACTACAGGTGCGTTTGCTGCTAAATCACTAATGGCTAAGCGAGATCTTGAACTGAGAGAAAAGAACAAACACATCTTGACTCTTGAAAAGGAAATTGCGCTAATGAGACAGAAAGCAGAACACACATCTGACTATGAAAATCTCAAAAAACTCAACTCTGAACTGCAAGCTGAGGTCACGAGCTTATGTAAGGTCA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa28850
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104718 Nonsense 937 1683 19 33
Genomic Location (Zv9):
Chromosome 17 (position 23313266)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23463415
GRCz11 17 23483439
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGCTAAATCACTAATGGCTAAGCGAGATCTTGAACTGAGAGAAAAGAAC[A/T]AACACATCTTGACTCTTGAAAAGGAAATTGCGCTAATGAGACAGAAAGCA
Long Flanking Sequence:
AATTTGTTAAATGATCTATTTTGAGACCATACACAGTAAAATTGCATGCCACAGACACATCAAAACCAATATAAATATATACATACCTTATAAAGTTTTCTCAATTCTTTGTAGGCCCCCCGGAGGACTTGAAAATGCCTGAAGATGAAGCAGATGATGGGCGGGAAGACTCCGCCCTTCATGAGGTCAAAGGTCAGCTGGAGTGTTGCCTTGCTGAAGCCAAACAAAAAGACAAGCAGATCACAGACCTTGAGCAGGAATGCCACAGATTACAAGTGTGCATTCAGGATCAAAAGTCAAATCTGGATGAAAGAGTGTCACAGGAACATATTCTGAAAGAAGACGTTTGTCAGACAACATTGGAAAGCAAACAGATGGCAACGGCTGTGGATTTTAGCAATCTGAACGTAGCAGTTGCATCCAGATGTAGCAACACTACAGGTGCGTTTGCTGCTAAATCACTAATGGCTAAGCGAGATCTTGAACTGAGAGAAAAGAAC[A/T]AACACATCTTGACTCTTGAAAAGGAAATTGCGCTAATGAGACAGAAAGCAGAACACACATCTGACTATGAAAATCTCAAAAAACTCAACTCTGAACTGCAAGCTGAGGTCACGAGCTTATGTAAGGTCAAAGCCGAACTTGAGGAGAAGATTACATGCCTTCAGAAGGAGAAGGAGGGGCTTGAAGATAAGGAGGTGGGGCTGACAAACCCTAACACTCTTGGATTTAAAAGTAAAGAGAGAGATAACCAAACACACCTCATGCTGTCTGGAAAGGAGGCTGAACTTGCACTGAGAGAGAATGCTCTAACTTTAAAGGAAACTCAGCTTTCAGCACTACAGAAGAGTCTGAAGCAAACACAGGAGCGTCTGGAGGAGGAGGAGATGCAGGCGGTGCAGGAGGCGCGCAGGAAGGAGGTGGAGAGGAGGAGAGAGATCCTGGCTGTGGCAGAGGAGGCCATCGCTCAGAAAGATGCAGAGCTACAGAAGAGACAAGTAGAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19174
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104718 Nonsense 1232 1683 23 33
ENSDART00000104718 Nonsense 1232 1683 23 33
Genomic Location (Zv9):
Chromosome 17 (position 23317407)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23467556
GRCz11 17 23487580
KASP Assay ID:
2261-1007.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCAAGAGCGTGAGCGTGTTATTGAAGACATGCGCTTGGCTCTGACAGAA[C/T]AGGAGGAAACACAGACACAGCTGGACCTTGAGTTGGACAACAGAGACGCT
Long Flanking Sequence:
GAAAAAACGAAAGTGCAGCTCCAGAATGAGATCGCCAACAGAGATCGCACCATTAACCAGTTAAAAGCTGTAAGCATGTCCAGCAATTGATTACCTAAACCTACAGATAGATTTCCCAATATGAATGGAAGGGCATCCGCTGTGTAAAACATATGCTGGATAAGTTGGCGTATCCAGCATATGTTGTGGTGACCCCTAATGAATGAAGGGATTAAACTTAGGGAAAATGAATGAATGAACCTACAGGTAGCGAAACATTCATTAAATTTGTTATGGGACTTGAATGTGTTTGCTTTTCTTAAACAGGAACGATCCTCTGGTTCAAAGTCAGATGAGAATCTGCTGCTCTATCAGAAAGCATGTAAAGGTATCTCTCCTGCATCATTGGTTTCGTGTGTGACAACAAGCAGCAACACATCTATTAATGTATGTATTAATGGTCTCTAGATCTGCAAGAGCGTGAGCGTGTTATTGAAGACATGCGCTTGGCTCTGACAGAA[C/T]AGGAGGAAACACAGACACAGCTGGACCTTGAGTTGGACAACAGAGACGCTCGGATTGATGAGCTCACTCAAGGTACAGGATAAATGGAGAGTATTGCAATCATGTTTGGGCTTAAATGATGCTCTGTGGTGAGCAGAATCTACTCAGACCAAGTTACAGGGCTGTAACAGGTCTTGGAATTTTTGGAATATCATGGAATTTTACAAGGTCTATTACAGACATTGATAGTCAGGGATTTTTTTATTTTTTTTGTCCAAGTCATGGAATTTCAGGGAATTTTACTTATTTTTAGCTTAATTTTTTCATTTATTAAATGTGCTTTGTCTATAAATTGTACAGAAAACGACACTGTTTCAACCCTATTGTTATGGTTATATGCTAATTTATCTGAGTTAAATTATCCATTGTTTTTCTTCTCATAGTGGCTATTAAAGTTATCCAGTTTTGATACTCTTGTTATATTAATATATTATTTTTATGTTTTATATATATATATATAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2945
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104718 Nonsense 1232 1683 23 33
ENSDART00000104718 Nonsense 1232 1683 23 33
Genomic Location (Zv9):
Chromosome 17 (position 23317407)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23467556
GRCz11 17 23487580
KASP Assay ID:
2261-1007.1 (used for ordering genotyping assays)
KASP Sequence:
TGCAAGAGCGTGAGCGTGTTATTGAAGACATGCGCTYGGCTCTGACAGAA[C/T]ARGAGGAAACACAGACAMAGCTGGACCTTGAGTTGGACAACARAGACGCT
Long Flanking Sequence:
GAAAAAACGAAAGTGCAGCTCCAGAATGAGATCGCCAACAGAGATCGCACCATTAACCAGTTAAAAGCTGTAAGCATGTCCAGCAATTGATTACCTAAACCTACAGATAGATTTCCCAATATGAATGGAAGGGCATCCGCTGTGTAAAACATATGCTGGATAAGTTGGCGTATCCAGCATATGTTGTGGTGACCCCTAATGAATGAAGGGATTAAACTTAGGGAAAATGAATGAATGAACCTACAGGTAGCGAAACATTCATTAAATTTGTTATGGGACTTGAATGTGTTTGCTTTTCTTAAACAGGAACGATCCTCTGGTTCAAAGTCAGATGAGAATCTGCTGCTCTATCAGAAAGCATGTAAAGGTATCTCTCCTGCATCATTGGTTTCGTGTGTGACAACAAGCAGCAACACATCTATTAATGTATGTATTAATGGTCTCTAGATCTGCAAGAGCGTGAGCGTGTTATTGAAGACATGCGCTTGGCTCTGACAGAA[C/T]AGGAGGAAACACAGACACAGCTGGACCTTGAGTTGGACAACAGAGACGCTCGGATTGATGAGCTCACTCAAGGTACAGGATAAATGGAGAGTATTGCAATCATGTTTGGGCTTAAATGATGCTCTGTGGTGAGCAGAATCTACTCAGACCAAGTTACAGGGCTGTAACAGGTCTTGGAATTTTTGGAATATCATGGAATTTTACAAGGTCTATTACAGACATTGATAGTCAGGGATTTTTTTATTTTTTTTGTCCAAGTCATGGAATTTCAGGGAATTTTACTTATTTTTAGCTTAATTTTTTCATTTATTAAATGTGCTTTGTCTATAAATTGTACAGAAAACGACACTGTTTCAACCCTATTGTTATGGTTATATGCTAATTTATCTGAGTTAAATTATCCATTGTTTTTCTTCTCATAGTGGCTATTAAAGTTATCCAGTTTTGATACTCTTGTTATATTAATATATTATTTTTATGTTTTATATATATATATATAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7830
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104718 Nonsense 1255 1683 23 33
Genomic Location (Zv9):
Chromosome 17 (position 23317476)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23467625
GRCz11 17 23487649
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCTGGACCTTGAGTTGGACAACARARACGCTCGGATTGATGAGCTCACT[C/T]AAGGTACAGGATAAATGGAGAGTATTGCAATCATGTTTGGGCTTAAATGA
Long Flanking Sequence:
GTAAGCATGTCCAGCAATTGATTACCTAAACCTACAGATAGATTTCCCAATATGAATGGAAGGGCATCCGCTGTGTAAAACATATGCTGGATAAGTTGGCGTATCCAGCATATGTTGTGGTGACCCCTAATGAATGAAGGGATTAAACTTAGGGAAAATGAATGAATGAACCTACAGGTAGCGAAACATTCATTAAATTTGTTATGGGACTTGAATGTGTTTGCTTTTCTTAAACAGGAACGATCCTCTGGTTCAAAGTCAGATGAGAATCTGCTGCTCTATCAGAAAGCATGTAAAGGTATCTCTCCTGCATCATTGGTTTCGTGTGTGACAACAAGCAGCAACACATCTATTAATGTATGTATTAATGGTCTCTAGATCTGCAAGAGCGTGAGCGTGTTATTGAAGACATGCGCTTGGCTCTGACAGAACAGGAGGAAACACAGACACAGCTGGACCTTGAGTTGGACAACAGAGACGCTCGGATTGATGAGCTCACT[C/T]AAGGTACAGGATAAATGGAGAGTATTGCAATCATGTTTGGGCTTAAATGATGCTCTGTGGTGAGCAGAATCTACTCAGACCAAGTTACAGGGCTGTAACAGGTCTTGGAATTTTTGGAATATCATGGAATTTTACAAGGTCTATTACAGACATTGATAGTCAGGGATTTTTTTATTTTTTTTGTCCAAGTCATGGAATTTCAGGGAATTTTACTTATTTTTAGCTTAATTTTTTCATTTATTAAATGTGCTTTGTCTATAAATTGTACAGAAAACGACACTGTTTCAACCCTATTGTTATGGTTATATGCTAATTTATCTGAGTTAAATTATCCATTGTTTTTCTTCTCATAGTGGCTATTAAAGTTATCCAGTTTTGATACTCTTGTTATATTAATATATTATTTTTATGTTTTATATATATATATATATATCCCTGTTTTTCAGGACAAAGCAATGGTTCTGAAAAGATTTGGTGTGTCCTAGTATTGTTTCATTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32150
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104718 Nonsense 1308 1683 25 33
Genomic Location (Zv9):
Chromosome 17 (position 23318455)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23468604
GRCz11 17 23488628
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGTGGCTTTTAGCTTGCCAATGAGAAGCAGCAGGCAGAACGCAAGAAGTG[G/A]ATGGAGGAGAAGTTGATTCTGATTGGTCAGGCTAAAGAAGCTGAGGAGAG
Long Flanking Sequence:
GTCCTAGTATTGTTTCATTGAACAACTGATTTAAATTACAAATACTAAATATGCAGAGGTGGATTTAGTCACACTATTACATAGCCTGTAATTTTCAGCTTGATTTCAGTATAGGCTGTTTTAGGACTAACAAAAATTTTCTGAAACGTGCAGGATGTTTTGTTGTCCTTGAACACCATAAAATCCAAAAACTAAAATCTAAAACAGACTCATGGTTATGTTGTTAATCTTTTGGACTTTACTGTTTATTTACAGAGCTGGCCAGTTTGAGAGAAATGTTGCCTGAAGAGAGGGACAGGAGTGATTCCAGACCAATCTCTAAAGATGTTTTACAGGCCAGACAGCAGATCACTCAGGCCCACGAGAGCTTACAGGTCCATGATCCAAATGCATTCTCGATTTCACTTAGTGTAAGAAAAGAAGTTTGCTCATGGTCTTTTTCTGGTTCTTCGTGGCTTTTAGCTTGCCAATGAGAAGCAGCAGGCAGAACGCAAGAAGTG[G/A]ATGGAGGAGAAGTTGATTCTGATTGGTCAGGCTAAAGAAGCTGAGGAGAGGCGGAATCAGGACATGAGACGATTTGCAGATGATCGAGAACGGCATGTTCGGCAACAGGCTGAAATGGTAAAGAGAAGAGTGTGCTTTTAAAGTCAATGTCAGGCAGATGTGTTCTAAAGATAATGATTGTCTGTTAATGTTTGTCTATTAGGAGTCTCTGGCTGCACGTCTTAATGCCCGTGAGGAAGAGATGGAAAGGTGGAGAAAGGAGAGAGACACGCTTGTCTCTGCTCTGGAGGTTCAGCTGAAGAAACTCATCATGTCCAATGGAGAAAAAGACCAACAGATCAAGATGCTGCAGTCCAGTAACACTGCCCAAACACCAGAGGTCAGTGAAGGGTCCCTTGCAGCTCTCATAAGTTCCTGCTTTTTCTATTTTTTTTATAAATCTGCAGTCAGTAAGATTTTTCTTTGCTAAATTAATATTTCATTTCACCAAAAATTGGAGC
Associated Phenotype:
Not determined