Busch Lab

ZMP

si:ch211-107m8.2

Ensembl ID:
ENSDARG00000070995
ZFIN ID:
ZDB-GENE-081104-521
Description:
inositol polyphosphate-4-phosphatase, type I-like [Source:RefSeq peptide;Acc:NP_001122019]
Human Orthologue:
INPP4A
Human Description:
inositol polyphosphate-4-phosphatase, type I, 107kDa [Source:HGNC Symbol;Acc:6074]
Mouse Orthologue:
Inpp4a
Mouse Description:
inositol polyphosphate-4-phosphatase, type I Gene [Source:MGI Symbol;Acc:MGI:1931123]

Alleles

There are 9 alleles of this gene:

Allele Name Consequence Status Availability
sa38543 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa8633 Nonsense Mutation detected in F1 DNA Not yet available
sa10195 Nonsense Available for shipment Available now
sa33832 Nonsense Available for shipment Available now
sa20671 Nonsense Available for shipment Available now
sa10910 Nonsense Available for shipment Available now
sa18836 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa38543
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061745 Essential Splice Site 275 940 9 22
ENSDART00000100762 Essential Splice Site 266 917 9 21
Genomic Location (Zv9):
Chromosome 6 (position 14138266)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 14098228
GRCz11 6 14227665
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAATGTCTGATGAGAGTGTCTTGACATAATTTTGTGTTGTGATGCTGGTA[G/A]GGTATCTGAGCTGGAGGAGTTGGGAGAATTATCCCCATGTTGGGAGAATC
Long Flanking Sequence:
CAATTGAACAATTGAACAGTTGAAGCTTTGCAATTAAATAATAGAACAATTGAAGCTTCGCAAAATGAAGCACATACTTGGCACACCAGGTAAACATACATTAGAATTGACTTGTTTAAAAATATTGCAATTTTTAAATTAAACATATAATCTATAAGTGCTTTTAGCTTATTATAAGTTTAAGTGTCTGCATAATATGCATTCTTTTATACTTTTTAAGGCTTTTATATATTGTTTGTTCCATAGTGGGCACTTCTAAAATGTCCAATAAGATACTAATCCCTATTATTAACTATTATTTCTTTTCAATTAACAAATGTCTTATTAAAACCTATACAAACTTGTAAAACTGATCTGAGATCAGGTATAAACTATGAAACCTGATTTGCCACTGGGGTGAAAATGAACAAACTAGTGTTTATAGATAGTTTTCTAATTTTGATCTCCACTGAATGTCTGATGAGAGTGTCTTGACATAATTTTGTGTTGTGATGCTGGTA[G/A]GGTATCTGAGCTGGAGGAGTTGGGAGAATTATCCCCATGTTGGGAGAATCTCAGGCGGCAGATTGTAACACAGTACCAGAGCATCCTTCTGTCCTATCAGGACACACGGTCAGACCTGCAGGACTACAAAGGTCAGTCTGTACTTTAAGTTTGCCGGAGGTGTTTCTGTTTTGTTATACATAAATCTCTTCAGAAGCTTCAGATATTCAGTACTTAAGCACAAGATCTATGAAAACAGAAACATATGATGAATGAGCTTCAAAGATGTTAGACTACATTAATTGTCTGTCTGGGATTTAAAGTTTGATTTAGGATTTCTAAACAAATTAGCTTTTTAAATAAAAAAGGGACGTAAATTCTAATTTTGCACTACTTTATTGCCAATAGTGAAATAGTTACTTGATCTAGCTTGATTGATATAATAATTATTATCATCAATACCTAAACTAATCACTACCCTAATAACTTTTAATAAACTGCAAATTATGAGTTTATTAAGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3607
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061745 Nonsense 384 940 11 22
ENSDART00000100762 Nonsense 373 917 11 21
Genomic Location (Zv9):
Chromosome 6 (position 14130670)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 14090632
GRCz11 6 14220069
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGCGGCTCACTGTCAGGGCTTCAAAAGCGGTGGTCTACGGAAACTCCTG[C/T]AGAAGTTTGAAGAGGCAAAGAAAGTGTAAGTTGGCCTGGTTTTGCAAAAC
Long Flanking Sequence:
CAACCTTGGCCAGATCTGTACCTTGCCACAATTTTGTCTCTGAGCTCTTCAGGCGGTTTCTTTGACCTCATGATTCTCATTTGCTCTGACATGCATTATGATCTTGTAAGGTCTTATATAGGCAGGTGTGTGGCTTTCCTAATTAAGTTCAATCAGTATAATCAAACACAGCTGGACTCAAATGAAGCTGTACAAAGAGTAAAACATCTAAGGGGGTCTGAATACTTTCCGTACCCACTGTAGATCTGCATGTACTATTGAATAATCCCAAGAAACAAACTACTCTAAGTCAATATTAAGAACTTGCTTTTCATCAGTGTAGTTTATTGCTTACACTATGTATTCGTTATTCATTATGATTGTTTGTGGGAAGTGTGAACTGGCTATGTGTATGTGTGTGTTTGTTTGTTGATCTAGATCACACCTATGATGTGGTGACGATCGGGGCCCCTGCGGCTCACTGTCAGGGCTTCAAAAGCGGTGGTCTACGGAAACTCCTG[C/T]AGAAGTTTGAAGAGGCAAAGAAAGTGTAAGTTGGCCTGGTTTTGCAAAACGTAAACCATTTCCTGCATGTGTGTGTATGCGTCTGTATGCATGTGAAGCAAAAGCTATCATGCTATCATTATTTGTGGTGATAAGCTAAGCCATAGACAGCATTTTTTGATGCATATCTGTTTGGCTAACCAGCTGTCTGGTATTGTTTTACCTAAAAAGATTTGATCAGTTTCCGATATGCTTTAATATGTGTAATATATTTGTAATATATTTGTAGTTCACCCAAACTAAAAATTCTGTCATTATTTACTCACCTTCCACTTAGTTAAAAACTTATTTGACTTTCTTTCTTCTGTTGAACACCAGAGAATATAGTTTGGGGGAAGCTGGAGACTGGTAATCATTGGTTTCCATAGTATTTGTTTTTTCTACTATGGAAGTCAATGGTTAAAGGTTTTTAGCCTTTAATATTCAACAGAATAAAGAAAGTAAGGTAATGTTTCACTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8633
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061745 Nonsense 527 940 13 22
ENSDART00000100762 Nonsense 516 917 13 21
Genomic Location (Zv9):
Chromosome 6 (position 14120225)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 14080187
GRCz11 6 14209624
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
YGGCAGCAACAGCCGTTCATCCCTCCATGTTGATTGGCATGAGGAAGAGT[G/A]GGTAAGAAAAYWTCTCTTAKATTTTTATTTTAATTACAATATTTTAWTAM
Long Flanking Sequence:
AGACAAAACCTTCCTGGCCAAAATCCCAGGCACATAGTTTGATTGTTTTGTGTTACATAAACATGATCAAACTTTTAGATTTTCTCTATGGTGCTGTAACCTAAAGATGCTCAAGTTCTGGTACTCATGCAACTGATAGTGAACTGCCATCTGCTCATCTGCATTCTAGGGAGAGGCTTACTGATAGCTCAATTTTGAGTTGTTTTTTTTTTTTTTTTTTTTTTTTACTTGTCCCCAGCGTGGTCTTTGGCTGAAACTATAATCTGTTTTTCTCACTCACTTTCAGACTCGACAGCTAGTGACGGTGTGTGACTGTAAACTGCTGGCGTCTGCAGTGCAGGCCCTGAACGCAGCAAGACCTGAGTACATCGCCTCGAAAAACTCACCCTCGGCTGACTCAGAGCAGGTGGTGCTGAGGAACGATCAAGACACACTGCTGGCCAAATGGAGTGGCAGCAACAGCCGTTCATCCCTCCATGTTGATTGGCATGAGGAAGAGT[G/A]GGTAAGAAAACATCTCTTAGATTTTTATTTTAATTACAATATTTTATTACTGTGACAATGTAAATTAATACAATTTAAAATCGCATATTCTATTTTATTTTATTATGTTTGTATGGTTTAAAGTGAATTTAAGAACTGTTATTGCATTATTAAAGTATTATTTCCCATCCCTGAATACATACTGTACATACATACATACATACATACATACATACATACATACATACATAAACACATACATACATACATACATAGATATTTTTTGGGGACTTCCCAATAGACAAATGTATTTTTATTCTGTATAAAGTCTATATTCTATCCCCTTCCCAAGTCGTTCACAAAGTTGGGGGTATGCTCTTTATACAAATCGTGTCTTTTCTACAGGAAAAGGTGTGGGGCAATGTGGACAAGAGTCTGGAGTGTATAATCCAGCGAGTGGACAAGCTGCTGCAGAGAGAGCGTCTGCACAGCAGCAGCAGTGAGGACATGTTCCAGTCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10195
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061745 Nonsense 668 940 17 22
ENSDART00000100762 Nonsense 645 917 16 21
Genomic Location (Zv9):
Chromosome 6 (position 14104945)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 14064907
GRCz11 6 14194344
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTTCATTATCAAGCTGAGAAACTGTCTCCGTGATGATGGTTTTCTAAGA[C/T]AGCTTTAYACCATYGGCCTGYTCGCTCAGTTTGAGTGTCTRTTGAGTACC
Long Flanking Sequence:
TCTGTCATCATTTTTCCTGTTAAAACTCATACAGTAAGTGTTTAAAGCAGCTTTGGACATATGCTTTTAAGCTTTCTAAGTGAATATACATTTGCATGTCAACTTAACCAGAGATAAAAATGTTCTGTTAGTCAATAATGATAAACATAAATTGTGTTAAAAGCAAAAATAGTCAATGTCTTGGGTGGATTATTGTTATTTCTATTGTTATCCACTAGTATATGCAATCTATATAGTATATGTAATCTATTAGGTTGTCCACTTATGTAGAGTTTTTAAATGCACAGGTTTTTTCCATGCAATGACAATTCATACAGAATTAGAATGACATATTGAATATGTAATTATAAATGTTTTGGGTGAACTATCCAAACCAATTTTCATTTAATTCTAACGTGTATTCTGTTTCTTATCTTTTTGTGTCTTTTAAGCTCACAGCGCTAATTTGTGGCTTCATTATCAAGCTGAGAAACTGTCTCCGTGATGATGGTTTTCTAAGA[C/T]AGCTTTACACCATCGGCCTGCTCGCTCAGTTTGAGTGTCTATTGAGTACCTACGGTAAACCTACTCTCACAAATATGCTCATTCTTTGCTCCTGAATATGCAGTATTTACTAAATTAAACCACTTATGTTATTAAAAACATATATGTAGGACATACAGTTGAAGTCAGAAATATTACCCCCTTGATATATATATATATATATATATATATATATATATATATTTCCCTATTTTCTGTTTTAACAAATTTCTAAACATAATGGTTTTAATAACTAATTTCTAATACTTTACTAGATATTTTTTCAAGAAACCAATATTCAGCTTAAAGCAGGGGTCTCAAACTGCCATTTACGGTCCACCCTCCTCCTCCCTCTGGCTGGCAACTGATGTCAAAAACATAACGACATTCGCCCCACCAAAACATATATTTTAGAACCTCGATCATTATTTTGCAGTCACATCTATCCGCTTGTGGTTTTGACCCTCCAACTAGTCGACATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26709
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061745 Essential Splice Site 845 940 20 22
ENSDART00000100762 Essential Splice Site 822 917 19 21
Genomic Location (Zv9):
Chromosome 6 (position 14101157)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 14061119
GRCz11 6 14190556
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCACGCTAGGAAAAATAAAAATGTTGACATCTTGTGGCAGGCTGCTGAG[G/A]TAACTGTTCTTTGCTTATTTTGAGATAATAAAGGGTGAAACGATTAAATG
Long Flanking Sequence:
TACTGAACCTACACACAAGAGCCCGAGACAAATGTTCACTTAAGAAGAAGATTTTAAATGACATTTAGAGGTTTTTGCATCTGAACACTGCAATAGCATTTCTCTAGCAAAATGTTATATTACAAGACATATCATTATTACTTAACAACAATATCGCATATTTTTCCTCTAACATGGATCTCCAGTTTACACAGATTGACTATATCTGGAAATGTCTTGTAGGTTTGGAGACACATCACTTCAGGAGCTCATCAATGTGGAAAGTCTGGCAAGACTAAATTCTTACTACCAGCAGTTCAAGGAGGTTTTACCGGACGACTGTAAGTCAGGAAAGTTTTGCATTATTTGAGTTACACAAGTCAGGTTTTAATTTTCTGTCTCTTTCAGGTCTTCCTCACTCTCGTAGTCAGACTTGTCTCCCAGAGCTGTTGCGGTTTCTGGGTCAAAATGTTCACGCTAGGAAAAATAAAAATGTTGACATCTTGTGGCAGGCTGCTGAG[G/A]TAACTGTTCTTTGCTTATTTTGAGATAATAAAGGGTGAAACGATTAAATGCTTAATGGGGATAATTAAAGAGTGGGTTTAAGCAGTTCTCTTTGATTAAAAGAATTAAAAGAATTTTTTTTTTTTTTTTTTTTAAACCACCTGTAGTTCATGTAAAAAAACTGTTTAGGTAAAAAGAAAGATAAAAGTAAAAGGTTTAAAGAGAAATTTACAAGTAATGCGAAAACGCATACTTTTAATGATGAAAATTGGAAGCGAAAGCCAAATTTTAGGAATTTTAGGGGATTTAGAAATCCGTCACATTTATTTCAGTCGTTTTTTTCATTTCTTTTTAATTTTAGCAAGTAATCAAGGCTTGACATTAACACCAGCCAATTTCACCCACCCGTTGATTTCATCTGTGGTGGGTTAGGCAGACACTCCCACTAGCCACTTTGGCTGGTTGAAAATCATTTTTAAATTAGAGTTTTTTTAAAAACAGGCTTCGACAATAAGGATGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33832
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061745 Nonsense 854 940 21 22
ENSDART00000100762 Nonsense 831 917 20 21
Genomic Location (Zv9):
Chromosome 6 (position 14098904)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 14058866
GRCz11 6 14188303
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAATATTTGTGCCTCTACATGCTCAGATTTGCCGACGACTGAACGGAGTG[C/T]GATTCACCAGCTGCAAAAGTGCCAAGGACCGCACTGCCATGTCAGTAACC
Long Flanking Sequence:
ATTTTCAGTAATTTTACAGACTTCTCTATATATCATTTATCATAGCTTATATTCTTTTAAACTACTAAAATGTCGATAAAAGTCACTTTGTTCAACTGTAGAGTTAAATTTTCAAGATCAAAACTCAACAGAGCACGAATCAGGGTTCCGTAATGCAATTCACAACCTGAAATGAATAGAAAACACTTGTGAAACACAAAATACAGAAACTTAATTAACAGATATGTTTTACAGTATAAATGGTACACCCATTTAATTTGCAGCATATTCTGTAAGCTGAAAAAACAATCACAGCAGACAGTGAATTACTGGGTTACTTAGTTCACACATAATAACAACATACAGGTTTAAAAATATTATTATTGTTTTTATTATTATTATTATTATTATTATTCATCACAGTAACAACTGAATTGGCATATAGGAGCATGAACAAAATTGGTTTTAAATCAATATTTGTGCCTCTACATGCTCAGATTTGCCGACGACTGAACGGAGTG[C/T]GATTCACCAGCTGCAAAAGTGCCAAGGACCGCACTGCCATGTCAGTAACCCTGGAGCAGTGTCTGATCCTGCAGCACGAGCATGGCATGGCCCCGCAGGTCTTCACACAGGCCCTCGACTGCATGCGCAGGTAAGAAACCTCAACAACTGCCTGTTTATAAGCACTGCACGCTTTGGGGATGTGCCTCTTTTTTTCATTCTCATTTAAATGCATCATCCTTCATTGCTTGCTGCTTTTTGGTGTTTTAGTAGGTTTTTATTGCTCTGTGCTTCATTCAGCCTTATAAGTTTGCTCATTTGTTTACTGGTTTCGTTTGCTCCTTCATACTTCATCCTTTCATCTCCTCTCTCCACGCTCTACTAGAGACACAAATGCAAATAAATGGCTCCTGTAGAGTGTGAGGAAGCTGCTGAAACTTGGATCCGCTGATTTTGTTTTGCTTGCCAGATGTTCTGTGCTTATAAATAAGAGTTTGAACTGTCAGGTTTTGTGCCGTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20671
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061745 Nonsense 911 940 22 22
ENSDART00000100762 Nonsense 888 917 21 21
Genomic Location (Zv9):
Chromosome 6 (position 14084260)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 14044222
GRCz11 6 14173659
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATCCCAGCGAGGGCTGCCGTCGCGAGAATACCACGAAGAACGTTGGATG[T/A]CGCAAGTATGCCTTTAACTGTCTGCAGCTGAAGGCTTTTCCTAAACATTA
Long Flanking Sequence:
ATCAATTCATATGTATAAAACATTTGAAAATGCACTGTTCGAATCTCAAAAAGAGGGCAGATGGTCAAAAGTAATTATTATACAGCCGATGTAGCCTGCTAATCTTATTTCTTTCTCTTTTGTCACATTTCTGTCAAATGATTTGCTTCAGAGCTTTGACTGCATCTATGCTACCCAAAAAATGCAGGACTTTTAGTGAGCCTCTTTGCTTATAGCAATGCTGCGTTAGCATTTTCAGCTTGTTTTAGCTGTGTTATGACATTGTTTGCTTGTTTGTTTGTTTACGCTTTTTTTATTTTTGAATGGTGACTGGCTTCCGCCACCCTCATACCCTGTTCACCGATGATACTCATGCTCATTACACTGCTGAAATGTCTTTTGTGGCTGTGCTAATTTTTGCCTGTGGTTTTTCTAAACATGGCTTCATGTTCTGTTTGTTTTCACTCACTCAATCCCAGCGAGGGCTGCCGTCGCGAGAATACCACGAAGAACGTTGGATG[T/A]CGCAAGTATGCCTTTAACTGTCTGCAGCTGAAGGCTTTTCCTAAACATTACAGACCTCCTGATGGCACTTTCGGAAAAGTGGAGACTTGATGAGACTGACATGATACGGAAATATTAGTAATTATGAAGCTTCTTCAAACTAAGTACAGTAAATCTGCTCAATTTGCTCTGAAGATAATCGCATATTTACACTTCAGGCGTGCGTTTGAAGTGAAAATGCTGACTGCACTGAATTGTATCAATAGATACAGTTCTATTTCATAAGCTCAGTATCACCAAACATATTTATTACATGTAATGCTGTATTTTAGCGTATTGTAGTTCACGGTGAAGGATTTAATCACTGTCAATATTGTATTTAGCAATCTTGGCCCTTTAGAGTGCAAATAGAGGGTTTAGACCTTTATGCTGAATATAATCATGCAGTATTGACTATCTATTGCAAAGATTTGTGTTTAGTATCCTAAAGAAATAGTTCACCCAACTATGAAAAATTGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10910
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061745 Nonsense 920 940 22 22
ENSDART00000100762 Nonsense 897 917 21 21
ENSDART00000061745 Nonsense 920 940 22 22
ENSDART00000100762 Nonsense 897 917 21 21
Genomic Location (Zv9):
Chromosome 6 (position 14084235)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 14044197
GRCz11 6 14173634
KASP Assay ID:
2259-7328.1 (used for ordering genotyping assays)
KASP Sequence:
AGAATACCACGAAGAACGTTGGATGTCGCAARTATGCCTTTAAYTGTCTG[C/T]AGCTGAAGGYTTTTCCTAAACATTACAGACCTCCYGAYGGCACTTTYGGA
Long Flanking Sequence:
GAAAATGCACTGTTCGAATCTCAAAAAGAGGGCAGATGGTCAAAAGTAATTATTATACAGCCGATGTAGCCTGCTAATCTTATTTCTTTCTCTTTTGTCACATTTCTGTCAAATGATTTGCTTCAGAGCTTTGACTGCATCTATGCTACCCAAAAAATGCAGGACTTTTAGTGAGCCTCTTTGCTTATAGCAATGCTGCGTTAGCATTTTCAGCTTGTTTTAGCTGTGTTATGACATTGTTTGCTTGTTTGTTTGTTTACGCTTTTTTTATTTTTGAATGGTGACTGGCTTCCGCCACCCTCATACCCTGTTCACCGATGATACTCATGCTCATTACACTGCTGAAATGTCTTTTGTGGCTGTGCTAATTTTTGCCTGTGGTTTTTCTAAACATGGCTTCATGTTCTGTTTGTTTTCACTCACTCAATCCCAGCGAGGGCTGCCGTCGCGAGAATACCACGAAGAACGTTGGATGTCGCAAGTATGCCTTTAACTGTCTG[C/T]AGCTGAAGGCTTTTCCTAAACATTACAGACCTCCTGATGGCACTTTCGGAAAAGTGGAGACTTGATGAGACTGACATGATACGGAAATATTAGTAATTATGAAGCTTCTTCAAACTAAGTACAGTAAATCTGCTCAATTTGCTCTGAAGATAATCGCATATTTACACTTCAGGCGTGCGTTTGAAGTGAAAATGCTGACTGCACTGAATTGTATCAATAGATACAGTTCTATTTCATAAGCTCAGTATCACCAAACATATTTATTACATGTAATGCTGTATTTTAGCGTATTGTAGTTCACGGTGAAGGATTTAATCACTGTCAATATTGTATTTAGCAATCTTGGCCCTTTAGAGTGCAAATAGAGGGTTTAGACCTTTATGCTGAATATAATCATGCAGTATTGACTATCTATTGCAAAGATTTGTGTTTAGTATCCTAAAGAAATAGTTCACCCAACTATGAAAAATTGCTGGTTATTTATCCAGGTCATCTAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18836
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061745 Nonsense 920 940 22 22
ENSDART00000100762 Nonsense 897 917 21 21
ENSDART00000061745 Nonsense 920 940 22 22
ENSDART00000100762 Nonsense 897 917 21 21
Genomic Location (Zv9):
Chromosome 6 (position 14084235)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 14044197
GRCz11 6 14173634
KASP Assay ID:
2259-7328.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAATACCACGAAGAACGTTGGATGTCGCAAGTATGCCTTTAACTGTCTG[C/T]AGCTGAAGGCTTTTCCTAAACATTACAGACCTCCTGATGGCACTTTCGGA
Long Flanking Sequence:
GAAAATGCACTGTTCGAATCTCAAAAAGAGGGCAGATGGTCAAAAGTAATTATTATACAGCCGATGTAGCCTGCTAATCTTATTTCTTTCTCTTTTGTCACATTTCTGTCAAATGATTTGCTTCAGAGCTTTGACTGCATCTATGCTACCCAAAAAATGCAGGACTTTTAGTGAGCCTCTTTGCTTATAGCAATGCTGCGTTAGCATTTTCAGCTTGTTTTAGCTGTGTTATGACATTGTTTGCTTGTTTGTTTGTTTACGCTTTTTTTATTTTTGAATGGTGACTGGCTTCCGCCACCCTCATACCCTGTTCACCGATGATACTCATGCTCATTACACTGCTGAAATGTCTTTTGTGGCTGTGCTAATTTTTGCCTGTGGTTTTTCTAAACATGGCTTCATGTTCTGTTTGTTTTCACTCACTCAATCCCAGCGAGGGCTGCCGTCGCGAGAATACCACGAAGAACGTTGGATGTCGCAAGTATGCCTTTAACTGTCTG[C/T]AGCTGAAGGCTTTTCCTAAACATTACAGACCTCCTGATGGCACTTTCGGAAAAGTGGAGACTTGATGAGACTGACATGATACGGAAATATTAGTAATTATGAAGCTTCTTCAAACTAAGTACAGTAAATCTGCTCAATTTGCTCTGAAGATAATCGCATATTTACACTTCAGGCGTGCGTTTGAAGTGAAAATGCTGACTGCACTGAATTGTATCAATAGATACAGTTCTATTTCATAAGCTCAGTATCACCAAACATATTTATTACATGTAATGCTGTATTTTAGCGTATTGTAGTTCACGGTGAAGGATTTAATCACTGTCAATATTGTATTTAGCAATCTTGGCCCTTTAGAGTGCAAATAGAGGGTTTAGACCTTTATGCTGAATATAATCATGCAGTATTGACTATCTATTGCAAAGATTTGTGTTTAGTATCCTAAAGAAATAGTTCACCCAACTATGAAAAATTGCTGGTTATTTATCCAGGTCATCTAAGAT
Associated Phenotype:
Not determined