Busch Lab

ZMP

sergef

Ensembl ID:
ENSDARG00000070986
ZFIN ID:
ZDB-GENE-061220-11
Description:
Sergef protein [Source:UniProtKB/TrEMBL;Acc:Q08BJ6]
Human Orthologue:
SERGEF
Human Description:
secretion regulating guanine nucleotide exchange factor [Source:HGNC Symbol;Acc:17499]
Mouse Orthologue:
Sergef
Mouse Description:
secretion regulating guanine nucleotide exchange factor Gene [Source:MGI Symbol;Acc:MGI:1351630]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa38010 Nonsense Mutation detected in F1 DNA Not yet available
sa6797 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30205
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104659 Nonsense 102 423 3 12
Genomic Location (Zv9):
Chromosome 25 (position 8399108)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 8011632
GRCz11 25 8135724
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCCACAGATTCAGGCGAGCTGCTGGTGTGTGGACAGAACCACAAGGGT[C/T]AGCTAGGGCTCGGTCACACCTTAGAGATTATGACCTTTCAGACCTGCCCT
Long Flanking Sequence:
TAAATGTAACTTGGTTAAACCTGCAGAAACCCTGTCAGACACTTTCTCCTTTTTTCATTCTCTCCACAGACTCAATATTACCTCACAATATTAAATGAGAACAGAAAATGAGTAATTTCAAATACTGTAACTATAGAAATAATGATACCAAATGTAATAATAATAATGTAATAAAAAAATAACAATTCATAGTGAATGGTTTGGCTTTATCATTGACTTTATCATATCATTTACTTTATAGTTTCTTATCATTTCTCAAATGTTTATAAGACAAAGCTTAAACTTGAATCGCCCAAAACTAATTCTTCTCTTTTCTTCGACATTTATGAATGCAATATTTTCCAAACAAAATAAACAGAAATTCCAGAAATGCCTTAAAGAACTTTCGAAGAATCACTCCAAATCTATTAAGTACAAATACAGTCAACAAAAAGATGACAAATACTTAATTCTCCACAGATTCAGGCGAGCTGCTGGTGTGTGGACAGAACCACAAGGGT[C/T]AGCTAGGGCTCGGTCACACCTTAGAGATTATGACCTTTCAGACCTGCCCTTTACCTGGGTTTGGAAGAGTTCAGCAGGTGTCCTGTGGGTGGGACTTCACCATTATCCTGACAGGTGAGTGTTTGGGTCATTAAATTCATATGTGGTGTGATCCTTCTTCATAAAACCATTCATTAAGGTATGCTTTGTAAGAGAGAGATCTTTACATGATCCTAATTCTGAACACTGTATTACTCATATTGCCATGAACATAACCAATGCTGGAGTGGTACAGGGGCTCAGTGGTTAGTCACCTCACAGCAAGAAGATTGCTGGTTCAAGTCCCAGCTGGGCCAGATGGCATTTCTGTGGAGTTTGCATGTTCTCACCGTGTTAGCGTGGGATTCCTCCGGGTGCTCTGGTTTCCCCCACAGTCCAAAGACATGCGCTATAGGTGAATTGAATAAGCTAAATTGTCCGTAGAGTGTGTGTGTATGGGTGTTTCCGAGGGCATCCGCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38010
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104659 Nonsense 117 423 3 12
Genomic Location (Zv9):
Chromosome 25 (position 8399061)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 8011585
GRCz11 25 8135677
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTCAGCTAGGGCTCGGTCACACCTTAGAGATTATGACCTTTCAGACCTG[C/A]CCTTTACCTGGGTTTGGAAGAGTTCAGCAGGTGTCCTGTGGGTGGGACTT
Long Flanking Sequence:
CCTTTTTTCATTCTCTCCACAGACTCAATATTACCTCACAATATTAAATGAGAACAGAAAATGAGTAATTTCAAATACTGTAACTATAGAAATAATGATACCAAATGTAATAATAATAATGTAATAAAAAAATAACAATTCATAGTGAATGGTTTGGCTTTATCATTGACTTTATCATATCATTTACTTTATAGTTTCTTATCATTTCTCAAATGTTTATAAGACAAAGCTTAAACTTGAATCGCCCAAAACTAATTCTTCTCTTTTCTTCGACATTTATGAATGCAATATTTTCCAAACAAAATAAACAGAAATTCCAGAAATGCCTTAAAGAACTTTCGAAGAATCACTCCAAATCTATTAAGTACAAATACAGTCAACAAAAAGATGACAAATACTTAATTCTCCACAGATTCAGGCGAGCTGCTGGTGTGTGGACAGAACCACAAGGGTCAGCTAGGGCTCGGTCACACCTTAGAGATTATGACCTTTCAGACCTG[C/A]CCTTTACCTGGGTTTGGAAGAGTTCAGCAGGTGTCCTGTGGGTGGGACTTCACCATTATCCTGACAGGTGAGTGTTTGGGTCATTAAATTCATATGTGGTGTGATCCTTCTTCATAAAACCATTCATTAAGGTATGCTTTGTAAGAGAGAGATCTTTACATGATCCTAATTCTGAACACTGTATTACTCATATTGCCATGAACATAACCAATGCTGGAGTGGTACAGGGGCTCAGTGGTTAGTCACCTCACAGCAAGAAGATTGCTGGTTCAAGTCCCAGCTGGGCCAGATGGCATTTCTGTGGAGTTTGCATGTTCTCACCGTGTTAGCGTGGGATTCCTCCGGGTGCTCTGGTTTCCCCCACAGTCCAAAGACATGCGCTATAGGTGAATTGAATAAGCTAAATTGTCCGTAGAGTGTGTGTGTATGGGTGTTTCCGAGGGCATCCGCTGTGTAAAACAGGTAGTTTATTCTGCTGTGGCGACGTCTGAAATAGAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6797
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104659 Nonsense 369 423 11 12
Genomic Location (Zv9):
Chromosome 25 (position 8373606)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7986130
GRCz11 25 8110222
KASP Assay ID:
554-4642.1 (used for ordering genotyping assays)
KASP Sequence:
GGTTACATCTGTCTCTGTCTGTCTCTCTTCAGGGGGTCGGGTCTTCTCCT[G/A]GGGCTGGAATGAACATGGAATGTGTGGCGACGGTTCCCTTCAGGACATCA
Long Flanking Sequence:
ATTATATTATATTATATTATACTTTTTTGATTAATTAGTAAATGAAATGGGTGACACGGTGGCTCTGCGGTTAGCACTGTTACCTCACAGCAAATAGGTTGCTGGTTCGAGTCTTGGTTGGGTCAGTTGGCATTTCTGTGTGGAGTTTGCATGTTCTCCCCATGTTGGTGTGGGTTTCCCTCACAGCCCAAAGATATGCGTTATAGGTGAATTGAATAAACTAAATTGGCTGTAGTGTATGTGTGTCAATGAGGGTGTATAGCTGTTTCCTAGTACTGGGTTGGGGCTGAAAGGGTATCCGCTGTGTAAAACATATGCTGGAATAGTTGGCGGTTCATTCCGCTGTGGCGACCCCCGATAAATAAAGGGACTAAGCCGAAAGAAAAGGAATGAATAAATGAATAGTATATAAAATAAAGATCCATAAATATCCATCTTTCCATGGTCATGGGTTACATCTGTCTCTGTCTGTCTCTCTTCAGGGGGTCGGGTCTTCTCCT[G/A]GGGCTGGAATGAACATGGAATGTGTGGCGACGGTTCCCTTCAGGACATCACACAACCTCAGCCAATCCCTGCTCTCGCCGATGCTGTGGCTCTTCTGATTGGCTGTGGAGCAGGGCATTCAATGGCACTGTGCAGTTTGAAGAGCAGTGAAGACTCAGCAAGATGAGCAGGTTAAACTTTCACCTCTCTGACTGTCACAGAAACTGTCAGCTTACACAACCGTTTAATGAATTATTCACAACGGCACATTTAAAACTTTAAAGGACAAGATTTAGATAAAAAAATCACACACACATTAAAAAGGTTTAAAATATGCAACATAATGCTAAAAATAATTTTGTTTAGGCTGACTACATTCATGTCTTAAATTAGATTATTTATTTAATTATTTTAGTTGGCTAAATGTACACTTTAGTATGTTAAGACAAGACACAGGTGAATAGGGTATAAAAATGAATTAAATTAACAAAAAAATGAATGTTTATCACAATATTTTTCAC
Associated Phenotype:
Not determined