Busch Lab

ZMP

ash1l

Ensembl ID:
ENSDARG00000070981
ZFIN ID:
ZDB-GENE-030131-6101
Description:
Novel protein similar to vertebrate ash1 (Absent, small, or homeotic)-like (Drosophila) (ASH1L) [Sou
Human Orthologue:
ASH1L
Human Description:
ash1 (absent, small, or homeotic)-like (Drosophila) [Source:HGNC Symbol;Acc:19088]
Mouse Orthologue:
Ash1l
Mouse Description:
ash1 (absent, small, or homeotic)-like (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2183158]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa18097 Nonsense Available for shipment Available now
sa43225 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa43226 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4786
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052915 Nonsense 967 2962 2 25
ENSDART00000127755 Nonsense 943 2938 2 25
Genomic Location (Zv9):
Chromosome 19 (position 9669151)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9127690
GRCz11 19 9046615
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCCACCACTCATTCTCATTTCCACCGCCTACTTTTTCAGCCCCCTCTGCT[C/T]GATCTGTAGCAAGTGCTGCAACATCCACTGCACACCCATCTCAGAAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18097
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052915 Nonsense 1526 2962 2 25
ENSDART00000127755 Nonsense 1502 2938 2 25
Genomic Location (Zv9):
Chromosome 19 (position 9670828)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9129367
GRCz11 19 9048292
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGAACGGTACAAGCGAAAAGAGGCCTCTATGTCTTGTCTTGGGCCCTCA[C/T]GACTGTCTWTGGGCACTGCAAGTCGGGGACATCATCCTGTTGACTCCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43225
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052915 Essential Splice Site 1985 2962 5 25
ENSDART00000127755 Essential Splice Site 1961 2938 5 25
Genomic Location (Zv9):
Chromosome 19 (position 9673901)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9132440
GRCz11 19 9051365
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTCCAGGTGAACATGACTATGGCCTTCTTCCTGCTCCCATTCATGTTGG[T/C]GAGTTTCTACAAATTTTAACCTGCCTAAATTTAGCCCAATATCTGTTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43226
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052915 Essential Splice Site 2179 2962 10 25
ENSDART00000127755 Essential Splice Site 2155 2938 10 25
Genomic Location (Zv9):
Chromosome 19 (position 9681111)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9139650
GRCz11 19 9058575
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCGCTTTGTCAACCACAGCTGCGAGCCCAACTGTGAGATGCAGAAATGG[T/A]GAGTAAAAATGAGACCATGGATGAGTCACTCAATAAAATCCCATCAGCTT
Associated Phenotype:
Not determined