Busch Lab

ZMP

si:rp71-15k1.1

Ensembl ID:
ENSDARG00000070964
ZFIN ID:
ZDB-GENE-030131-1113
Description:
hypothetical protein LOC322393 [Source:RefSeq peptide;Acc:NP_001073414]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa13921 Nonsense Available for shipment Available now
sa44905 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa1946 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13921
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104623 Nonsense 145 522 7 18
Genomic Location (Zv9):
Chromosome 19 (position 9903074)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9361613
GRCz11 19 9280538
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACAAATTTCATTAGATGATTTGTTCATTACAGAGAAGTGGATTCATATTA[T/A]CTTCCAGGAGCTCCACCGATCTACAGTAAACCCATGGAGTTCCTTGGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44905
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104623 Essential Splice Site 468 522 16 18
Genomic Location (Zv9):
Chromosome 19 (position 9911524)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9370063
GRCz11 19 9288988
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGATGAAGAGCGAAGCGTTTACTCGAGAGGAGCTTGAAGAAACACCAAA[G/A]TAAGTGAAAAAAATCGAGGCCTGTGTTACAATCGGTATAGTTGCTATACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1946
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104623 Nonsense 521 522 18 18
Genomic Location (Zv9):
Chromosome 19 (position 9913985)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9372524
GRCz11 19 9291449
KASP Assay ID:
554-1934.1 (used for ordering genotyping assays)
KASP Sequence:
ATCAATGCGTGACACAAACAGAAGTTTACGGGATATGTGGGATCTACTGT[T/A]GGAATAATCTCTGTGAATGGAAAGCCAGGATTGCGACCGCAGTCAATATG
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461