Busch Lab

ZMP

zgc:153948

Ensembl ID:
ENSDARG00000070951
ZFIN ID:
ZDB-GENE-061013-204
Description:
high mobility group AT-hook 1-like [Source:RefSeq peptide;Acc:NP_001070744]
Human Orthologue:
HMGA1
Human Description:
high mobility group AT-hook 1 [Source:HGNC Symbol;Acc:5010]
Mouse Orthologues:
Hmga1, Hmga1-rs1
Mouse Descriptions:
high mobility group AT-hook 1 Gene [Source:MGI Symbol;Acc:MGI:96160]
high mobility group AT-hook I, related sequence 1 Pseudogene [Source:MGI Symbol;Acc:MGI:96161]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa7053 Nonsense Mutation detected in F1 DNA Not yet available
sa12236 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7053
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104603 Nonsense 7 92 1 4
Genomic Location (Zv9):
Chromosome 6 (position 54098084)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 54134818
GRCz11 6 54142926
KASP Assay ID:
554-5080.1 (used for ordering genotyping assays)
KASP Sequence:
TTGATTCCACGTGTTTTGAACAGACTGCAATCATGAGTGATTCAGAAAAA[C/T]AAACCGTCTCCCTTAAGGACAAGGATGGAGTAGAGAAAAGAGGACGAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12236
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104603 Nonsense 12 92 1 4
Genomic Location (Zv9):
Chromosome 6 (position 54098099)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 54134833
GRCz11 6 54142941
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGAACAGACTGCAATCATGAGTGATTCAGAAAAAYAAACYGTCTCCCTT[A/T]AGGACAAGGATGGAGTAGAGAAAAGAGGACGAGGAAGACCAAGGAAGCAT
Associated Phenotype:
Not determined