Busch Lab

ZMP

si:dkey-14o18.6

Ensembl ID:
ENSDARG00000070950
ZFIN ID:
ZDB-GENE-060503-428
Description:
Novel protein similar to vertebrate serine/threonine/tyrosine kinase 1 (STYK1) [Source:UniProtKB/TrE
Human Orthologue:
STYK1
Human Description:
serine/threonine/tyrosine kinase 1 [Source:HGNC Symbol;Acc:18889]
Mouse Orthologue:
Styk1
Mouse Description:
serine/threonine/tyrosine kinase 1 Gene [Source:MGI Symbol;Acc:MGI:2141396]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa39233 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa6546 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa11436 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39233
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104596 Essential Splice Site 18 435 2 9
ENSDART00000132124 None None 255 None 6
Genomic Location (Zv9):
Chromosome 19 (position 10294680)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9753219
GRCz11 19 9672144
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACACTAGATCTGTTTATTATTATTGAAATTGTGTTTCTATTTCTCCTTGC[A/T]GAGGTGCTTTTTTATCAAGTCGAACTGATCGTCGTTCCAGTTCTGTTCCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19212
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104596 Nonsense 225 435 4 9
ENSDART00000132124 Nonsense 60 255 1 6
ENSDART00000104596 Nonsense 225 435 4 9
ENSDART00000132124 Nonsense 60 255 1 6
Genomic Location (Zv9):
Chromosome 19 (position 10297270)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9755809
GRCz11 19 9674734
KASP Assay ID:
2261-2978.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGTGGAGGAGCTGGAGCACAGAGACCTGCTGGGCTTCCTGTGGAGGTGC[A/T]GACAGGTACGTGACTAATGCTTAATTCTGTGTTTAGCGGTGGACCAAAAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3034
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104596 Nonsense 225 435 4 9
ENSDART00000132124 Nonsense 60 255 1 6
ENSDART00000104596 Nonsense 225 435 4 9
ENSDART00000132124 Nonsense 60 255 1 6
Genomic Location (Zv9):
Chromosome 19 (position 10297270)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9755809
GRCz11 19 9674734
KASP Assay ID:
2261-2978.1 (used for ordering genotyping assays)
KASP Sequence:
CGGTGGAGGAGCTGGAGCACAGAGACCTGCTGGGCTTCCTGTGGAGGTGC[A/T]GACAGGTACGTGACTAATGCTTAATTCTGTGTTTAGCGRTGGACCAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6546
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104596 Essential Splice Site 339 435 7 9
ENSDART00000132124 Essential Splice Site 169 255 4 6
Genomic Location (Zv9):
Chromosome 19 (position 10299476)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9758015
GRCz11 19 9676940
KASP Assay ID:
554-4581.1 (used for ordering genotyping assays)
KASP Sequence:
CTTCATAGATGGTCCTTTGGYATTTTGCTCTATGAGATGGTGACATTAGG[T/C]GAGTGTGTCCGTTGACAAGTTTTGTGGTTTTCAGTTACAGAGAGCATGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11436
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104596 Nonsense 410 435 9 9
ENSDART00000132124 Nonsense 240 255 6 6
Genomic Location (Zv9):
Chromosome 19 (position 10303640)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9762179
GRCz11 19 9681104
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCCGAAAGCTCCAATCAGGAGAGRGAAGYGCAAATGATCAGGCAGTGCTG[C/T]GAGTGTCGGAGCCGCTGGACATAGAGAAATACATGCAAGAGGCGGGATWT
Associated Phenotype:
Not determined