Busch Lab

ZMP

dnajc27

Ensembl ID:
ENSDARG00000070916
ZFIN ID:
ZDB-GENE-081022-93
Description:
DnaJ homolog subfamily C member 27 [Source:UniProtKB/Swiss-Prot;Acc:Q6IMK3]
Human Orthologue:
DNAJC27
Human Description:
DnaJ (Hsp40) homolog, subfamily C, member 27 [Source:HGNC Symbol;Acc:30290]
Mouse Orthologue:
Dnajc27
Mouse Description:
DnaJ (Hsp40) homolog, subfamily C, member 27 Gene [Source:MGI Symbol;Acc:MGI:2443036]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1897
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123114 Nonsense 259 273 7 8
Genomic Location (Zv9):
Chromosome 17 (position 33509735)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 33351466
GRCz11 17 33303977
KASP Assay ID:
554-1887.1 (used for ordering genotyping assays)
KASP Sequence:
TACTGTTGCACCCAGACAAGTGTGTGGCCCCAGGCAGCGAGGATGCCTTT[A/T]AAGCAGTGGTTAATGCTCGCACGTCCCTCCTCAAGAATATCAAGTAGGAT
Associated Phenotype:
Not determined