Busch Lab

ZMP

zgc:158268

Ensembl ID:
ENSDARG00000070907
ZFIN ID:
ZDB-GENE-061201-6
Description:
ligand-dependent corepressor [Source:RefSeq peptide;Acc:NP_001073441]
Human Orthologue:
LCOR
Human Description:
ligand dependent nuclear receptor corepressor [Source:HGNC Symbol;Acc:29503]
Mouse Orthologue:
Lcor
Mouse Description:
ligand dependent nuclear receptor corepressor Gene [Source:MGI Symbol;Acc:MGI:2443930]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa15929 Nonsense Available for shipment Available now
sa24210 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4183
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104471 Nonsense 247 521 7 7
ENSDART00000110442 Nonsense 171 464 6 6
ENSDART00000143191 Nonsense 283 576 6 6
Genomic Location (Zv9):
Chromosome 22 (position 37649759)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 34842047
GRCz11 22 34816929
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACCCCTCAAGCCACCGTTGGCCCGCTCACTCCTTATAAAAGAGGAACTGT[T/A]GAGCCAGAAACATCGCCTCCTTGGCCAACCAACACCTCTTTCTTTGGCTA
Long Flanking Sequence:
GCTGGGATCCACAATAGAAGTTTGTTTTGGGACAACAAGAAGGAATTAGGTTAACTTATTAGTTTACAAATTTACGTGGATTGAACTCAAAACACTTAAGTTGTACAGTATTGAGCACAAGAACAACTACACATGTATGCCATAATTGAAATAATTGAATCATTAATAATGTTCCACATTTTGACAATGATAGGATTGGACCTAATAGTCTTAATAAAACTTCCCACAAAAGTCCTACTTTTTTCTAGAAGACAACAGAATTGATCATGTCCACCAAGTTCAGGACTTTATTCCAGTAACCTAACCTGTTCTCACATATGAACATCTTATTTTTCTACAAACTAGGCGTTCCCAGAGAGCTGATCACAACTATCGAGATGTTGACGATGAGGACGGCTTGCCACCGAGAAGCTTGCATGATGGGATAAGGGAGAACTGTATTGGTTCTGTACCCCTCAAGCCACCGTTGGCCCGCTCACTCCTTATAAAAGAGGAACTGT[T/A]GAGCCAGAAACATCGCCTCCTTGGCCAACCAACACCTCTTTCTTTGGCTAGCCTAGAGTCTGTGGGTCTCCTCAACAGCCAAGCCCAGTCTCTACTGTCCCGTGACGGTGCATGGGGGAAATCCCATTTGGACGGCCTCCTGAAGCTCAAACAAGACCTAAATGACCTGCCTCTTTTCCAGGAGAACCAAGGCGTGTTCACCAAGGGTTCAAAGTCCCATGACACTAGTCCCATCACGGTGAAGAAAGAGCCAGGGCATTCCCCTCCGGTGGACCTGAAGATCCCGCAAGTCCGAGGCATGGATCTGTCTTGGGACTCCCATGGGAACTCCTCAGATATCTACAGTTACAGCTCTTTAGCACTGAGCAACGTGCACTCAGAGAACGCACTCAGCAGGAAACTGAGAGCCATCTTGCCAAAGCAGAGTCGCCGGGCCGCTCTCGGAGGCCTTCTGGATGCAGGAGCTGTAGGCGAGTACTGGGGTGCAGACTTGGACCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15929
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104471 Nonsense 262 521 7 7
ENSDART00000110442 Nonsense 186 464 6 6
ENSDART00000143191 Nonsense 298 576 6 6
Genomic Location (Zv9):
Chromosome 22 (position 37649714)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 34842092
GRCz11 22 34816974
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTGTWGAGCCAGAAAMATCGCCTCCTTGGCCAACCAACACCTCTTTCTT[T/A]GGCTAGCCTAGAGTCTGTGGGTCTCCTCAACAGCCAAGCCCAGTCTCTAC
Long Flanking Sequence:
TTAGGTTAACTTATTAGTTTACAAATTTACGTGGATTGAACTCAAAACACTTAAGTTGTACAGTATTGAGCACAAGAACAACTACACATGTATGCCATAATTGAAATAATTGAATCATTAATAATGTTCCACATTTTGACAATGATAGGATTGGACCTAATAGTCTTAATAAAACTTCCCACAAAAGTCCTACTTTTTTCTAGAAGACAACAGAATTGATCATGTCCACCAAGTTCAGGACTTTATTCCAGTAACCTAACCTGTTCTCACATATGAACATCTTATTTTTCTACAAACTAGGCGTTCCCAGAGAGCTGATCACAACTATCGAGATGTTGACGATGAGGACGGCTTGCCACCGAGAAGCTTGCATGATGGGATAAGGGAGAACTGTATTGGTTCTGTACCCCTCAAGCCACCGTTGGCCCGCTCACTCCTTATAAAAGAGGAACTGTTGAGCCAGAAACATCGCCTCCTTGGCCAACCAACACCTCTTTCTT[T/A]GGCTAGCCTAGAGTCTGTGGGTCTCCTCAACAGCCAAGCCCAGTCTCTACTGTCCCGTGACGGTGCATGGGGGAAATCCCATTTGGACGGCCTCCTGAAGCTCAAACAAGACCTAAATGACCTGCCTCTTTTCCAGGAGAACCAAGGCGTGTTCACCAAGGGTTCAAAGTCCCATGACACTAGTCCCATCACGGTGAAGAAAGAGCCAGGGCATTCCCCTCCGGTGGACCTGAAGATCCCGCAAGTCCGAGGCATGGATCTGTCTTGGGACTCCCATGGGAACTCCTCAGATATCTACAGTTACAGCTCTTTAGCACTGAGCAACGTGCACTCAGAGAACGCACTCAGCAGGAAACTGAGAGCCATCTTGCCAAAGCAGAGTCGCCGGGCCGCTCTCGGAGGCCTTCTGGATGCAGGAGCTGTAGGCGAGTACTGGGGTGCAGACTTGGACCAGCCATCCTTGGGACCTCAGTACCCAACATCGGATCCCGAGGGAGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24210
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104471 Nonsense 478 521 7 7
ENSDART00000110442 Nonsense 402 464 6 6
ENSDART00000143191 Nonsense 514 576 6 6
Genomic Location (Zv9):
Chromosome 22 (position 37649066)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 34842740
GRCz11 22 34817622
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATGAGCGTTTCGAAGGCGCAGAACATCTATGGGATCCCCCACAGCACCT[T/A]GGAGTACAAGGTGAAAGAGAGGATGGGCACACTGAAGAACCCGCCAAAGA
Long Flanking Sequence:
CGTGTTCACCAAGGGTTCAAAGTCCCATGACACTAGTCCCATCACGGTGAAGAAAGAGCCAGGGCATTCCCCTCCGGTGGACCTGAAGATCCCGCAAGTCCGAGGCATGGATCTGTCTTGGGACTCCCATGGGAACTCCTCAGATATCTACAGTTACAGCTCTTTAGCACTGAGCAACGTGCACTCAGAGAACGCACTCAGCAGGAAACTGAGAGCCATCTTGCCAAAGCAGAGTCGCCGGGCCGCTCTCGGAGGCCTTCTGGATGCAGGAGCTGTAGGCGAGTACTGGGGTGCAGACTTGGACCAGCCATCCTTGGGACCTCAGTACCCAACATCGGATCCCGAGGGAGACCCAACAGGCTCCAAGCAACCCCGAAAGAAACGGGGACGGTATCGGCAGTACAACAGCGAGATTCTCGAAGAAGCCATTGCTGTGGTGATGAGTGGGAAGATGAGCGTTTCGAAGGCGCAGAACATCTATGGGATCCCCCACAGCACCT[T/A]GGAGTACAAGGTGAAAGAGAGGATGGGCACACTGAAGAACCCGCCAAAGAAAAAGCTTAAACTGATGATGAGGGCAGAGGGGCAGGACTCCGGGATCACCGGCGAAACCGAATCCATGTCAACGCCCGCCACCACACCCGTCGCAACGCAAGTGGACGTCTTGCAGGGGACAGGAGACAAAGTCGAGTAGATTACACAGAACACCTCATTTTAAAATGGAGAAAGTTTTAAATTCTGACAGACACAAACAAACAAACAAACAAAACCTAAAATGATTTGGAATTGGAGGATGGGGCTTTAATTGTGCCAATTTACTTGCAGTATCTGGGTGAGCACAACTGCAGGGATTCATGGGAGGATTTAAGCCTGATAACTGGGGATTAAGAAACCAATTGGCAGTTATCACAGTGGTCGACACTGCAAGCATTTGCTGATGTTTTTTTTTACAACAAAGCAACAAATGCGTACTAAAGCCATAAGAGAGTATCGACAGAGACGTT
Associated Phenotype:
Not determined