Busch Lab

ZMP

si:ch211-262h13.5

Ensembl ID:
ENSDARG00000070892
ZFIN ID:
ZDB-GENE-050208-372
Description:
hypothetical protein LOC571127 [Source:RefSeq peptide;Acc:NP_001038677]
Human Orthologue:
FETUB
Human Description:
fetuin B [Source:HGNC Symbol;Acc:3658]
Mouse Orthologue:
Fetub
Mouse Description:
fetuin beta Gene [Source:MGI Symbol;Acc:MGI:1890221]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa37575 Essential Splice Site Available for shipment Available now
sa43888 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7995
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104437 Nonsense 15 384 1 7
Genomic Location (Zv9):
Chromosome 22 (position 41864730)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 38832723
GRCz11 22 38819468
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCAAATATGTGGTCTCTGATTGGGATTTTGTCAGCTGCAAACGTTTTSTG[T/A]GTTTATGGGACAAGTTTAGTTCCTGTTCACKTTCCCTGTGATGACAAGAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3201
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104437 Nonsense 85 384 2 7
Genomic Location (Zv9):
Chromosome 22 (position 41864186)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 38832179
GRCz11 22 38818924
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCAGCTGGAAAGGTCTATTATCTGGATTTAGATGTCCTTGAGACCAAGTG[T/A]CACGTTCTCAGTCCCAAATCATGGAAGAAGTGTGCTGTAAGACCCTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37575
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104437 Essential Splice Site 133 384 3 7
Genomic Location (Zv9):
Chromosome 22 (position 41863376)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 38831369
GRCz11 22 38818114
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCAGAGGGTTTCTCTTACCTTTACAGCTATGACTGCACTCTCGTACCAG[G/A]TGAACCCCTCGTCCCAGTCAGACTGCATACATCTTCAACAGTTGCAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43888
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104437 Nonsense 223 384 6 7
Genomic Location (Zv9):
Chromosome 22 (position 41860664)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 38828657
GRCz11 22 38815402
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACTCAGTGTTTATACTGTATCTGCTTCCACTTTAGCCTGTTGGATTCTG[T/A]GTTGGGACGGTTTTTGGCACTGGCCACGGATTGCAAGATGTGAAGGTGTC
Associated Phenotype:
Not determined