Busch Lab

ZMP

bcl6a

Ensembl ID:
ENSDARG00000070864
ZFIN ID:
ZDB-GENE-040426-1696
Description:
B-cell lymphoma 6 protein [Source:RefSeq peptide;Acc:NP_957028]
Human Orthologue:
BCL6
Human Description:
B-cell CLL/lymphoma 6 [Source:HGNC Symbol;Acc:1001]
Mouse Orthologue:
Bcl6
Mouse Description:
B-cell leukemia/lymphoma 6 Gene [Source:MGI Symbol;Acc:MGI:107187]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa7042 Nonsense Mutation detected in F1 DNA Not yet available
sa45253 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa7042
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131126 Nonsense 179 718 4 9
Genomic Location (Zv9):
Chromosome 6 (position 27927101)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28228312
GRCz11 6 28218873
KASP Assay ID:
554-5439.1 (used for ordering genotyping assays)
KASP Sequence:
AAGACATTCACAGTTACAGACCCCATGAGGTTATGGATAATGTGTCAGGA[C/T]GATCAGCAACTTTCAGAGACGGGAGACCCTATGGTGTCTGCATGTTTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45253
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131126 Nonsense 385 718 4 9
Genomic Location (Zv9):
Chromosome 6 (position 27926482)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28227693
GRCz11 6 28218254
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAATGCTGCTCTCGCACAGGCCTTGCAACCTCCAACTTCTCAAGGTACAT[C/A]AGATCCTAAAGCTCGCAACTGGAAGAAATACAAGTTCATTGTGCTCAATC
Associated Phenotype:
Not determined