Busch Lab

ZMP

si:ch211-175f11.3

Ensembl ID:
ENSDARG00000070794
ZFIN ID:
ZDB-GENE-030219-197
Description:
Si:ch211-175f11.3 protein [Source:UniProtKB/TrEMBL;Acc:Q58EP6]
Human Orthologue:
GREB1
Human Description:
growth regulation by estrogen in breast cancer 1 [Source:HGNC Symbol;Acc:24885]
Mouse Orthologue:
Greb1
Mouse Description:
gene regulated by estrogen in breast cancer protein Gene [Source:MGI Symbol;Acc:MGI:2149712]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa36445 Nonsense Mutation detected in F1 DNA Not yet available
sa36446 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa36445
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104249 Nonsense 292 661 6 12
ENSDART00000139091 Nonsense 458 827 7 13

The following transcripts of ENSDARG00000070794 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 30471235)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30395162
GRCz11 17 30412125
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCTTTATCATGCCATGGAAGGAGCCACCCATCTGCACATTCTAGTGATT[A/T]AAGAGTATGAGATGGCCGTATACAAGAAATACTGGCCCAACCATATAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36446
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104249 Nonsense 591 661 11 12
ENSDART00000139091 Nonsense 757 827 12 13

The following transcripts of ENSDARG00000070794 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 30475363)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30399290
GRCz11 17 30416253
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTTTAGCACTACCGGACTGCTCTTTAGTGGCCTTCTCTTATACTTCTG[T/A]GACTCCTTTGTGACTCCTGGATTCCTTAAAAAGTTCCAGTTCCTGAAAGG
Associated Phenotype:
Not determined