Busch Lab

ZMP

irgf1

Ensembl ID:
ENSDARG00000070774
ZFIN ID:
ZDB-GENE-051212-5
Description:
immunity-related GTPase family, f1 [Source:RefSeq peptide;Acc:NP_001108170]
Human Orthologues:
IRGC, IRGM
Human Descriptions:
immunity-related GTPase family, M [Source:HGNC Symbol;Acc:29597]
immunity-related GTPase family, cinema [Source:HGNC Symbol;Acc:28835]
Mouse Orthologues:
9930111J21Rik1, 9930111J21Rik2, AC132320.1, BC023105, Gm12185, Gm4841, Gm4951, Gm5431, Ifi47, Igtp, Iigp1, Irgc1, Irgm1, Irgm2, Tgtp1, Tgtp2
Mouse Descriptions:
RIKEN cDNA 9930111J21 gene 1 Gene [Source:MGI Symbol;Acc:MGI:3041173]
RIKEN cDNA 9930111J21 gene 2 Gene [Source:MGI Symbol;Acc:MGI:3711310]
T-cell specific GTPase 1 Gene [Source:MGI Symbol;Acc:MGI:98734]
T-cell specific GTPase 2 Gene [Source:MGI Symbol;Acc:MGI:3710083]
cDNA sequence BC023105 Pseudogene [Source:MGI Symbol;Acc:MGI:2384767]
immunity-related GTPase family M member 1 Gene [Source:MGI Symbol;Acc:MGI:107567]
immunity-related GTPase family M member 2 Gene [Source:MGI Symbol;Acc:MGI:1926262]
immunity-related GTPase family, cinema 1 Gene [Source:MGI Symbol;Acc:MGI:2685948]
interferon gamma induced GTPase Gene [Source:MGI Symbol;Acc:MGI:107729]
interferon gamma inducible protein 47 Gene [Source:MGI Symbol;Acc:MGI:99448]
interferon inducible GTPase 1 Gene [Source:MGI Symbol;Acc:MGI:1926259]
interferon-inducible GTPase-like [Source:RefSeq peptide;Acc:NP_001094945]
predicted gene 12185 Gene [Source:MGI Symbol;Acc:MGI:3652173]
predicted gene 4841 Gene [Source:MGI Symbol;Acc:MGI:3643814]
predicted gene 4951 Gene [Source:MGI Symbol;Acc:MGI:3644953]
predicted gene 5431 Gene [Source:MGI Symbol;Acc:MGI:3645205]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa7456 Missense Mutation detected in F1 DNA Not yet available
sa15 Nonsense Confirmed mutation in F2 line Not yet available
sa23522 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7456
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104220 Missense 129 398 2 4
ENSDART00000134567 Missense 129 398 2 3
Genomic Location (Zv9):
Chromosome 19 (position 23784685)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23714100
GRCz11 19 23298423
KASP Assay ID:
554-4086.1 (used for ordering genotyping assays)
KASP Sequence:
GCCGATGAGTATCTCGAGTTGGTTGAGTTTGAGCGCTATGATTTTTTCAT[T/G]ATCATCGCTTCAGATAGATTYAGAGAATGCCACACTCAGCTGGCCAAAGW
Long Flanking Sequence:
TGAAACATCCTGTTACGACATCCTGAAAAAAATTTAATAAATCAATGATTTTTTCTCTTATGGCTAGTTTTTATGGCTTTTACCTCTTCAGTTAATAATGAGATTTTTCTTTAGATGGCTACATTTGAAGACTATTGTGTAATAACCCAGGAGGACCTGGATGATATTAAAGATTCAATATCTACACAGGATCTCCCATCAGCTGTAAACACTATAAAAGAGTATCTCAAACAGCAAGATCTCGTTGAACTTAACATTGGTGTGACTGGAGAGTCTGGTTCTGGAAAGTCCACATTTGTCAATGCATTCAGGGGTTTAGGAGATGAAGATGAGGGCTCTGCTGAAACTGGCCCTGTAGAAACCACTATGGAGCCTGAAGTTTATATTCACCCGAAATACCACAATGTGAAAGTGTGGGACCTTCCTGGCATTGGAACACCAAATTTTAAAGCCGATGAGTATCTCGAGTTGGTTGAGTTTGAGCGCTATGATTTTTTCAT[T/G]ATCATCGCTTCAGATAGATTTAGAGAATGCCACACTCAGCTGGCCAAAGAGATCATGAGGATGGGGAAGAAGTTTTACTTTGTTCGCTCCAAGATTGATGCAAGCATTACAGCTGAGAAGAAGAAGAAGAACTTTGACCAGAAAAAGACACTGGATTCCATCCGCAAGGACTGTATAAATGGTTAGTTTATTTGTTTTTTATGAGCAATGTAGAGAAATACATATTGTTTCAAAAATCATTGTATTGAACAAGGCTATTATTCTCATGTAGAAACAGCAATAACTTGAATTATTTTGAGACTTTTGTTTATACATCATCATGACATGTTACTTCTTTAATAGTATATTCTGTCTTTGATAGGTCTGAGAAAGATCGGTATAGAAGATCCCATTGTATTCCTGATCTCAGGCTGGGAGCTCAGCAAGTATGATTTAAATCTGCTGCAGGATAGAATGGAGAAAGAGCTTCCACAGCATAAGAGACGTGTACTGATGTTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104220 Nonsense 137 398 2 4
ENSDART00000134567 Nonsense 137 398 2 3
Genomic Location (Zv9):
Chromosome 19 (position 23784707)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23714122
GRCz11 19 23298445
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGAGTTTGAGCGCTATGATTTTTTCATTATCATCGCTTCAGATAGATTT[A/T]GAGAATGCCACACTCAGCTGGCCAAAGAGATCATGAGGATGGGGAAGAAG
Long Flanking Sequence:
CTGAAAAAAATTTAATAAATCAATGATTTTTTCTCTTATGGCTAGTTTTTATGGCTTTTACCTCTTCAGTTAATAATGAGATTTTTCTTTAGATGGCTACATTTGAAGACTATTGTGTAATAACCCAGGAGGACCTGGATGATATTAAAGATTCAATATCTACACAGGATCTCCCATCAGCTGTAAACACTATAAAAGAGTATCTCAAACAGCAAGATCTCGTTGAACTTAACATTGGTGTGACTGGAGAGTCTGGTTCTGGAAAGTCCACATTTGTCAATGCATTCAGGGGTTTAGGAGATGAAGATGAGGGCTCTGCTGAAACTGGCCCTGTAGAAACCACTATGGAGCCTGAAGTTTATATTCACCCGAAATACCACAATGTGAAAGTGTGGGACCTTCCTGGCATTGGAACACCAAATTTTAAAGCCGATGAGTATCTCGAGTTGGTTGAGTTTGAGCGCTATGATTTTTTCATTATCATCGCTTCAGATAGATTT[A/T]GAGAATGCCACACTCAGCTGGCCAAAGAGATCATGAGGATGGGGAAGAAGTTTTACTTTGTTCGCTCCAAGATTGATGCAAGCATTACAGCTGAGAAGAAGAAGAAGAACTTTGACCAGAAAAAGACACTGGATTCCATCCGCAAGGACTGTATAAATGGTTAGTTTATTTGTTTTTTATGAGCAATGTAGAGAAATACATATTGTTTCAAAAATCATTGTATTGAACAAGGCTATTATTCTCATGTAGAAACAGCAATAACTTGAATTATTTTGAGACTTTTGTTTATACATCATCATGACATGTTACTTCTTTAATAGTATATTCTGTCTTTGATAGGTCTGAGAAAGATCGGTATAGAAGATCCCATTGTATTCCTGATCTCAGGCTGGGAGCTCAGCAAGTATGATTTAAATCTGCTGCAGGATAGAATGGAGAAAGAGCTTCCACAGCATAAGAGACGTGTACTGATGTTGGCTTTGCCAAATATCACACTGGAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29204
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104220 Nonsense 152 398 2 4
ENSDART00000134567 Nonsense 152 398 2 3
Genomic Location (Zv9):
Chromosome 19 (position 23784752)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23714167
GRCz11 19 23298490
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATTTAGAGAATGCCACACTCAGCTGGCCAAAGAGATCATGAGGATGGGG[A/T]AGAAGTTTTACTTTGTTCGCTCCAAGATTGATGCAAGCATTACAGCTGAG
Long Flanking Sequence:
TTTTTATGGCTTTTACCTCTTCAGTTAATAATGAGATTTTTCTTTAGATGGCTACATTTGAAGACTATTGTGTAATAACCCAGGAGGACCTGGATGATATTAAAGATTCAATATCTACACAGGATCTCCCATCAGCTGTAAACACTATAAAAGAGTATCTCAAACAGCAAGATCTCGTTGAACTTAACATTGGTGTGACTGGAGAGTCTGGTTCTGGAAAGTCCACATTTGTCAATGCATTCAGGGGTTTAGGAGATGAAGATGAGGGCTCTGCTGAAACTGGCCCTGTAGAAACCACTATGGAGCCTGAAGTTTATATTCACCCGAAATACCACAATGTGAAAGTGTGGGACCTTCCTGGCATTGGAACACCAAATTTTAAAGCCGATGAGTATCTCGAGTTGGTTGAGTTTGAGCGCTATGATTTTTTCATTATCATCGCTTCAGATAGATTTAGAGAATGCCACACTCAGCTGGCCAAAGAGATCATGAGGATGGGG[A/T]AGAAGTTTTACTTTGTTCGCTCCAAGATTGATGCAAGCATTACAGCTGAGAAGAAGAAGAAGAACTTTGACCAGAAAAAGACACTGGATTCCATCCGCAAGGACTGTATAAATGGTTAGTTTATTTGTTTTTTATGAGCAATGTAGAGAAATACATATTGTTTCAAAAATCATTGTATTGAACAAGGCTATTATTCTCATGTAGAAACAGCAATAACTTGAATTATTTTGAGACTTTTGTTTATACATCATCATGACATGTTACTTCTTTAATAGTATATTCTGTCTTTGATAGGTCTGAGAAAGATCGGTATAGAAGATCCCATTGTATTCCTGATCTCAGGCTGGGAGCTCAGCAAGTATGATTTAAATCTGCTGCAGGATAGAATGGAGAAAGAGCTTCCACAGCATAAGAGACGTGTACTGATGTTGGCTTTGCCAAATATCACACTGGAGATTAATGAGAAGAAGAAGAAAGCTCTTGAGGAAAACATCAGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23522
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104220 Nonsense 207 398 3 4
ENSDART00000134567 Nonsense 207 398 3 3
Genomic Location (Zv9):
Chromosome 19 (position 23785098)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23714513
GRCz11 19 23298836
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGAGAAAGATCGGTATAGAAGATCCCATTGTATTCCTGATCTCAGGCT[G/A]GGAGCTCAGCAAGTATGATTTAAATCTGCTGCAGGATAGAATGGAGAAAG
Long Flanking Sequence:
GTGGGACCTTCCTGGCATTGGAACACCAAATTTTAAAGCCGATGAGTATCTCGAGTTGGTTGAGTTTGAGCGCTATGATTTTTTCATTATCATCGCTTCAGATAGATTTAGAGAATGCCACACTCAGCTGGCCAAAGAGATCATGAGGATGGGGAAGAAGTTTTACTTTGTTCGCTCCAAGATTGATGCAAGCATTACAGCTGAGAAGAAGAAGAAGAACTTTGACCAGAAAAAGACACTGGATTCCATCCGCAAGGACTGTATAAATGGTTAGTTTATTTGTTTTTTATGAGCAATGTAGAGAAATACATATTGTTTCAAAAATCATTGTATTGAACAAGGCTATTATTCTCATGTAGAAACAGCAATAACTTGAATTATTTTGAGACTTTTGTTTATACATCATCATGACATGTTACTTCTTTAATAGTATATTCTGTCTTTGATAGGTCTGAGAAAGATCGGTATAGAAGATCCCATTGTATTCCTGATCTCAGGCT[G/A]GGAGCTCAGCAAGTATGATTTAAATCTGCTGCAGGATAGAATGGAGAAAGAGCTTCCACAGCATAAGAGACGTGTACTGATGTTGGCTTTGCCAAATATCACACTGGAGATTAATGAGAAGAAGAAGAAAGCTCTTGAGGAAAACATCAGAAAAGTTGCCTTTCTGTCTGCTTGTGTTGCTCTTTTCCCCCTTCCTGGTCTTTCCATCAGTGCAGATATAGCCATCATAGCAGAAGAGCTGAGAAAGTACTACAGTGCATTTGGTCTGGATGATCCATCCCTGCAGAAACTCTGTGAACGATCAGGGAAAACCGTAGAGGAACTGAAGAGTCTGATGAAGTCTCCTCTGCATCACGGGATCAACCCAAGTTCAATATTAACCTTGCTGGGCGCTGCCTCTGTTCTTATATCAGAAGATGCTGTTGAGTTACTTGTGAGCTTCATACCCATTATTGGCTCTGTGGTGGCAGGAGGACTTTCTTATTTGACCGTCTCAGGAA
Associated Phenotype:
Not determined