Busch Lab

ZMP

zgc:173544

Ensembl ID:
ENSDARG00000070714
ZFIN ID:
ZDB-GENE-030131-6229
Description:
hypothetical protein LOC793869 [Source:RefSeq peptide;Acc:NP_001107102]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa21872 Nonsense Available for shipment Available now
sa7290 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
hu7860
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104107 Nonsense 93 697 3 3
Genomic Location (Zv9):
Chromosome 11 (position 16405655)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 15886355
GRCz11 11 16020990
KASP Assay ID:
554-2412.1 (used for ordering genotyping assays)
KASP Sequence:
GCCAATACTYACTGCATTTCCCACAGTACCATAAACAAGACTAYCACTTC[C/A]TGTTGAATCAACACTAGATCCTTGAAGTTGGCTTCTAGTGGAAGAATCAG
Long Flanking Sequence:
TTGAAAGCTTTTCTTTTTATTTTGTTGTGAACAGTGCATGGTTGGTTTGACCTGACCTGGCTTACTATGGGTGCAACAACAATGTGGATTTTAAGGTATGTTGTTTTAGGATTTGTTTATTTATTTATTTTTTTGCAGTTTAACGTTTACTATATGGCTGATGTTCTTTTTGCAGTTACTATTTAGCAGTACTTTTAGCCCTTGGTGCATGTGATGTTGCAACTAGTAAGTATTATTATTATTATGTCCAGCATTACATAATTGATCTAATGCTAATGGTTTATGTAGTTTTTGCATATAGCCCTGGTAGCAATGGTGGACTTCCTGGACCTAACAATCCCAGCAAGAGTACAATTTACAGTGCTGCAGTTAAAGGGGGTTATGACACCGAAAGCTACAGTTCCCAGGCTGGCTCTTCAGGCATTCTCATGGCGGTAGATAAAACTGGCTCTGATTCTTCCACTAGAAGCCAACTTCAGGGATCTGGTGTTTATTCAACG[G/T]GAAGTGGTAGTCTTGTTTATGGTACTGTGGGTAATGCAGTGAATGTTGGCATGTCTGGGAATGATGCAAGTCCATCAACTAATGTTCAACAATCTGAAGTCATTAGTTCGTCTGTCTTGATGCCATTTCAGCAAAGCAGTTATTCTGTTCCTAATCCAGTGCTGCTGACTAGTTCCCAGTCTGCAGTGCATGCTGGTAGAAGACCCCATAAGCCTCTAAGTGGTAAACGCCACCAATCTGGTTCCAATATTGTTTTAGGTTCCAGGCCATTTCAAAATCCGATATTCAACACTTTGAAGCCTCTTAAACCAATATTAGAGTATGGCAGTGTGCCAAGTAGCTTAGCAGTGGCCAGCTATGAACTTGTCAGCCAGTCCAGTGGCCAGACTGCAAATCATCCAAACGGTGTGCAGCCAATAGATGTTGTTGACATCTCTGTGGTCCAGCCCAGTAGCCAGCAGCTAATTCTAACAAGCCAATCTATTTCCCAGTCAAATGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21872
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104107 Nonsense 377 697 3 3
Genomic Location (Zv9):
Chromosome 11 (position 16404803)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 15885503
GRCz11 11 16020138
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCAACCAGCCCACATCAGCTACCAGTCTGTAGCCCAACCGATTGTTCAA[C/T]AAGCCAGCTATGAATCTGTGTCTCTTTCCAATGGAGCAAAACTTGTACAG
Long Flanking Sequence:
CCAGCTATGAACTTGTCAGCCAGTCCAGTGGCCAGACTGCAAATCATCCAAACGGTGTGCAGCCAATAGATGTTGTTGACATCTCTGTGGTCCAGCCCAGTAGCCAGCAGCTAATTCTAACAAGCCAATCTATTTCCCAGTCAAATGACCAGCAACCAGTTCATGGTAGTTCTGTCTTTACGGCTCAGCCCAGTGGTCCGACTCCCCTCAAGCACCATAAAGGTAAACATCAGTTTGGGTCCAAACTTCCATCCAGTACAAGTATTCTCCATACACCGAGTTCTGGTTTTGTAGTGCAGTCAACTAGCCAAATGCCAGTACAAACCATCTACCAGTCCGTGCCCAAACCTACTCTACAACTACCAGTGCAAGCCAGCTACCAATCAGAGGCCCAGTCTGCTTCTCAAAAGCCAGGACAAACCAGTTACCTGTCTGTGCCCCAAATTGTTGTCCAACCAGCCCACATCAGCTACCAGTCTGTAGCCCAACCGATTGTTCAA[C/T]AAGCCAGCTATGAATCTGTGTCTCTTTCCAATGGAGCAAAACTTGTACAGGCTGGCTCCCAATCAGAGGCCCAGCCAGGACCTATCAGCTACCAGTTTGTGGCCGAGCCCATTGTCCAACAGCCAGCACATGTTAGCCTTTCTGTAGTTCAACCGATCAACCAGCAAGCAGGACAATCTACCTATGAGTATGTTGTCGAGCAGAGTGGGCATCCCCTTCTCAAGCCAGTGCATGCCCATGGAGTTCATCAGATTGGCTCCAAGGTTTATTCATGCCAAGAGTTGCCTCAGCATGGTTACCAGAGGAGATTTCCGTCTCCACCTAGAACAAGTCTTTCAGCCCTAACTCGGCACTCCAAGCCTGTTGCACAGTCCAGCGACCAGGCATCTGCCAAGCCTAACCATCCTAGACCACTCGCATCTACTCTACAATCCATTTTAACACCAGCTCAAGTGTTATCTAGCCAGCAGTTTCTTTCTCGGCCCAGCTACACTCCCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7290
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104107 Nonsense 579 697 3 3
Genomic Location (Zv9):
Chromosome 11 (position 16404197)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 15884897
GRCz11 11 16019532
KASP Assay ID:
554-4452.1 (used for ordering genotyping assays)
KASP Sequence:
TCTCYCTYGSTGAAYACCWGAWATCTCCTGTTCCAGGGCAGTTTGTTTCC[C/T]AGCCTCAAATGCTTCCTAGTAGTMAGTCTCTCRCTSAGTCAAGCTCTTCT
Long Flanking Sequence:
AGCCCATTGTCCAACAGCCAGCACATGTTAGCCTTTCTGTAGTTCAACCGATCAACCAGCAAGCAGGACAATCTACCTATGAGTATGTTGTCGAGCAGAGTGGGCATCCCCTTCTCAAGCCAGTGCATGCCCATGGAGTTCATCAGATTGGCTCCAAGGTTTATTCATGCCAAGAGTTGCCTCAGCATGGTTACCAGAGGAGATTTCCGTCTCCACCTAGAACAAGTCTTTCAGCCCTAACTCGGCACTCCAAGCCTGTTGCACAGTCCAGCGACCAGGCATCTGCCAAGCCTAACCATCCTAGACCACTCGCATCTACTCTACAATCCATTTTAACACCAGCTCAAGTGTTATCTAGCCAGCAGTTTCTTTCTCGGCCCAGCTACACTCCCCAAGCTTTGCTAGTGGAACCCATGTACCAGCCTCTGGCACAATCAAATTCAGAGACCATCTCTCTCGGTGAATACCAGATATCTCCTGTTCCAGGGCAGTTTGTTTCC[C/T]AGCCTCAAATGCTTCCTAGTAGTCAGTCTCTCACTCAGTCAAGCTCTTCTTCCTCAGGCATGCCAGTGCAGTCCAGCTACCAGCCTCTGGTATCATCAAGTTATGAGACCGTCTTACAGCCTGGATTTCAGACCTCCTCAGTGCTTGTGCCATCAAGTTACCAATCTACAAGTTCCAAAGCATTGAGCGGTCCGGTAGTTTCAAGCCATGAGTCTGTGTTTCAGTCGGTTCAACCTGAACTTGCAGTTCCGCTACAGGTGGATTATCAGTCTGTCACAGGCCAAAATGCTCCTGGAACTGCTCAAAACATTAGGCATCCATCCCAGTTGTTCAGGCTGTTGCAACAAGTGAAGTCCTAGATACTTGTGTTCTGGTTCCAGAGTCATGTTTGCTGTCTGATGTCAATAAAACATTATTTAAATATCTTTGTGGATCTGTTTTATAACTTACCTTTTTTATTGTCATTTGCATCTGCAAAATCAAAATACAAAAGTTGATCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3798
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104107 Nonsense 646 697 3 3
Genomic Location (Zv9):
Chromosome 11 (position 16403995)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 15884695
GRCz11 11 16019330
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCAAGTTACCAATCTACAAGTTCCAAAGCATYGAGYGGTCCGGTAGTTT[C/A]AAGCCATGAGTCTGTGTTTCAGTCGGTTCAACCTGAACTTGCAGTTCCRC
Long Flanking Sequence:
ATTTCCGTCTCCACCTAGAACAAGTCTTTCAGCCCTAACTCGGCACTCCAAGCCTGTTGCACAGTCCAGCGACCAGGCATCTGCCAAGCCTAACCATCCTAGACCACTCGCATCTACTCTACAATCCATTTTAACACCAGCTCAAGTGTTATCTAGCCAGCAGTTTCTTTCTCGGCCCAGCTACACTCCCCAAGCTTTGCTAGTGGAACCCATGTACCAGCCTCTGGCACAATCAAATTCAGAGACCATCTCTCTCGGTGAATACCAGATATCTCCTGTTCCAGGGCAGTTTGTTTCCCAGCCTCAAATGCTTCCTAGTAGTCAGTCTCTCACTCAGTCAAGCTCTTCTTCCTCAGGCATGCCAGTGCAGTCCAGCTACCAGCCTCTGGTATCATCAAGTTATGAGACCGTCTTACAGCCTGGATTTCAGACCTCCTCAGTGCTTGTGCCATCAAGTTACCAATCTACAAGTTCCAAAGCATTGAGCGGTCCGGTAGTTT[C/A]AAGCCATGAGTCTGTGTTTCAGTCGGTTCAACCTGAACTTGCAGTTCCGCTACAGGTGGATTATCAGTCTGTCACAGGCCAAAATGCTCCTGGAACTGCTCAAAACATTAGGCATCCATCCCAGTTGTTCAGGCTGTTGCAACAAGTGAAGTCCTAGATACTTGTGTTCTGGTTCCAGAGTCATGTTTGCTGTCTGATGTCAATAAAACATTATTTAAATATCTTTGTGGATCTGTTTTATAACTTACCTTTTTTATTGTCATTTGCATCTGCAAAATCAAAATACAAAAGTTGATCTACGTTGCCGTCAACTTCATTTTTAAATTGCTCCCAATAGTTTCTTTGATAGGTTTCATGCAGTGACAATGTCTGCTGATATAAGGTTTTATTTGCAAAATACAATTGACACTGCAACCAGACATGTAACGTGTACTTCAAATAAAAAATGATCTAAAATGAAGTTTTTGCAATTGAATTTTTTAAATTTTTTTTTTTACAAT
Associated Phenotype:
Not determined