Busch Lab

ZMP

fezf2

Ensembl ID:
ENSDARG00000070677
ZFIN ID:
ZDB-GENE-001103-3
Description:
Fez family zinc finger protein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q804Q5]
Human Orthologue:
FEZF2
Human Description:
FEZ family zinc finger 2 [Source:HGNC Symbol;Acc:13506]
Mouse Orthologue:
Fezf2
Mouse Description:
Fez family zinc finger 2 Gene [Source:MGI Symbol;Acc:MGI:1859823]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa178 Nonsense Available for shipment Available now
sa278 Nonsense F2 line generated Not yet available
sa14758 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa178
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103997 Nonsense 171 438 2 5
ENSDART00000130308 Nonsense 163 430 2 5
Genomic Location (Zv9):
Chromosome 11 (position 20478041)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 19895355
GRCz11 11 20057697
KASP Assay ID:
554-0048.1 (used for ordering genotyping assays)
KASP Sequence:
TGTGTTATTTCAATTACCTGGACTCTGCTTATCAGTCTGAGCTGCTGAGT[G/T]GACATTTATTTTCTTCGGCAATCGCGAACTCTCAAGCACAAGCCATAAGC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa278
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103997 Nonsense 191 438 2 5
ENSDART00000130308 Nonsense 183 430 2 5
Genomic Location (Zv9):
Chromosome 11 (position 20478101)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 19895415
GRCz11 11 20057757
KASP Assay ID:
554-2891.1 (used for ordering genotyping assays)
KASP Sequence:
TTTCTTCGGCAATCGCGAACTCTCAAGCACAAGCCATAAGCGCKCATCAG[A/T]AGCTCCTCTTGTTGGAGAACGCTAAACTTGCTTGCGTTTCTCCTGAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14758
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103997 Nonsense 356 438 5 5
ENSDART00000130308 Nonsense 348 430 5 5
Genomic Location (Zv9):
Chromosome 11 (position 20479175)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 19896489
GRCz11 11 20058831
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTTAGAGAAAAAACTTACANNNNTATTTTGTTCTTTTTTCAGGGAATTA[C/A]AAGAASCACAAACTAACCCACAGCGGCGAGAAACAGTACAAGTGTTCAAT
Associated Phenotype:
Not determined