Busch Lab

ZMP

pex5

Ensembl ID:
ENSDARG00000070654
ZFIN ID:
ZDB-GENE-040426-981
Description:
peroxisomal biogenesis factor 5 [Source:RefSeq peptide;Acc:NP_957450]
Human Orthologue:
PEX5
Human Description:
peroxisomal biogenesis factor 5 [Source:HGNC Symbol;Acc:9719]
Mouse Orthologue:
Pex5
Mouse Description:
peroxisomal biogenesis factor 5 Gene [Source:MGI Symbol;Acc:MGI:1098808]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa10186 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10186
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103944 Nonsense 420 600 13 15
ENSDART00000123142 Nonsense 498 678 14 16
ENSDART00000145106 Nonsense 413 593 12 14
Genomic Location (Zv9):
Chromosome 16 (position 13823596)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 12182687
GRCz11 16 12073589
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAATTAATTTATGTGAGTTNNNNNNNNNNTGTTTCTCTTAGAGCACTGTTTGGTGAAGTG[C/T]AGACGTTGTTTYTGAATGCAGCGGCGGCTGAGCCCTCGCAGGTGGACCCG
Associated Phenotype:
Not determined