Busch Lab

ZMP

FGD5 (1 of 3)

Ensembl ID:
ENSDARG00000070653
Description:
FYVE, RhoGEF and PH domain containing 5 [Source:HGNC Symbol;Acc:19117]
Human Orthologue:
FGD5
Human Description:
FYVE, RhoGEF and PH domain containing 5 [Source:HGNC Symbol;Acc:19117]
Mouse Orthologue:
Fgd5
Mouse Description:
FYVE, RhoGEF and PH domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:2443369]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa14523 Nonsense Available for shipment Available now
sa24889 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa35058 Nonsense Mutation detected in F1 DNA Not yet available
sa21880 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4416
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103945 Nonsense 223 534 8 16
Genomic Location (Zv9):
Chromosome 11 (position 18826954)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18244268
GRCz11 11 18406610
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTGTGTGACTGTGTGTGTGTGTNNTGCAGATGAATGATGTGATGCTGTA[C/A]ACCTACCCTCAGCAGGAYGGCAAATACAGACTGAAGAACACACTCACTTT
Long Flanking Sequence:
AACTGCAGCAGATCGTCTTGACCATGCCTACATGCCTAAATGCATTGAGTTGCTGTCATGTGATTGACTGATTAGAAATTTGAATTAACAAGCAGTTGGACACTTGTACCTAATAAAGTGGCCGGTGAGTGTACGTAATCCGTAATGTTGTATTAAGTTGTAAGTGAGAATGTTTCCATGTTTTTACTTAAAATCCATAAAGAAATTAAATGACATTTACAATTGCGCAGGAACCACATCAATAAAAATTGGTGAACTGTTCAAAAAAGTTTTTAATAATTGTCTTAAGACAAGAATGGCAGCTCTTCAGTAGTTTAAATACATAGTAAATCTTTTCAATATCAATTAGAAATCAGATTTAATGTAACATTAAATTGATTAAATAGGAATATATTATCAAAAAAAGTCCTGTGTGTGGATTCCCAATTTGTATATAGTAAAATAAACTTGTTTGTGTGACTGTGTGTGTGTGTGTTGCAGATGAATGATGTGATGCTGTA[C/A]ACCTACCCTCAGCAGGACGGCAAATACAGACTGAAGAACACACTCACTTTAAGTGGAATGAAAGTAAGACATCTCTTCTTCTTTTTTTATGTTAGCTAACAAGAAAACAAACACTTTGGTTGACACTAAAAACTGCGTTATCAAGCAATGTAACACAAACATGCATTTCCCTGTGTCTAGGTCAGTAAACCCATCATAGACAATGTGCTGAACACACTCAGAATAGAAGTCAGCGACGTCACCATCACACTCTCAGCCAGGTAATCAACATTTCCAAAATGGTTTGCACACATCTGTATTGTCATTCACTGTCATAGTCACGTTTACGGCTTCTTTCTGTGCACGTCAGCTCTTTAGGAGAAAGAGAAGACTGGTTTCACACACTGAGTCGGGCTATCGCTGATCACGCCGCAGGCCTCAATACCTTCAGCAGCTCCAGCGAGGTGTGAGGAAATCATCATATCTTTATCCATTAGTACTCATTATTAAGAAGGAATAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14523
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103945 Nonsense 279 534 10 16
Genomic Location (Zv9):
Chromosome 11 (position 18826580)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18243894
GRCz11 11 18406236
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTACGGCTTCTTTCTGTGCAYGTCAGCTCTTTAGGAGAAAGAGAAGACTG[G/A]TTTCACACACTGAGTCGGGCTATMGCTGATCACGCCGCAGGCCTCAATAC
Long Flanking Sequence:
TTGATTAAATAGGAATATATTATCAAAAAAAGTCCTGTGTGTGGATTCCCAATTTGTATATAGTAAAATAAACTTGTTTGTGTGACTGTGTGTGTGTGTGTTGCAGATGAATGATGTGATGCTGTACACCTACCCTCAGCAGGACGGCAAATACAGACTGAAGAACACACTCACTTTAAGTGGAATGAAAGTAAGACATCTCTTCTTCTTTTTTTATGTTAGCTAACAAGAAAACAAACACTTTGGTTGACACTAAAAACTGCGTTATCAAGCAATGTAACACAAACATGCATTTCCCTGTGTCTAGGTCAGTAAACCCATCATAGACAATGTGCTGAACACACTCAGAATAGAAGTCAGCGACGTCACCATCACACTCTCAGCCAGGTAATCAACATTTCCAAAATGGTTTGCACACATCTGTATTGTCATTCACTGTCATAGTCACGTTTACGGCTTCTTTCTGTGCACGTCAGCTCTTTAGGAGAAAGAGAAGACTG[G/A]TTTCACACACTGAGTCGGGCTATCGCTGATCACGCCGCAGGCCTCAATACCTTCAGCAGCTCCAGCGAGGTGTGAGGAAATCATCATATCTTTATCCATTAGTACTCATTATTAAGAAGGAATAGTATGGCATTCTGCATCCCTGTGCATGTTTGCAGGCCAGAGAGAAGCTGTGGATGTCATTGGGAGAAGCTGCTCCTGTTCTGGTTCCTGTGTCTCATGTGATGATGTGCATGAACTGCACGTCTGACTTCAGTCTAACACTGCGACGGCATCACTGTAATGCATGCGGAAAGGTGAACATTTTTTACACAGAGTACATTTGGGTTCACAGATTTGATGTCCATTTGCTTATTTTCACTTCATCCAAGATTTTTGTTTTTGGTAAAACACTAAAGATTTTTATGCAGAACTGTGGAGCTTGGTTGTTTAAAAAACTAAAAACTATGGAGACTGTCACTTTGAGAGTCAAAAAATACAGTCACAGTTTAAATGAAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24889
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103945 Essential Splice Site 348 534 11 16
Genomic Location (Zv9):
Chromosome 11 (position 18826282)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18243596
GRCz11 11 18405938
KASP Assay ID:
554-7683.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGACTTCAGTCTAACACTGCGACGGCATCACTGTAATGCATGCGGAAAGG[T/A]GAACATTTTTTACACAGAGTACATTTGGGTTCACAGATTTGATGTCCATT
Long Flanking Sequence:
TGTGTCTAGGTCAGTAAACCCATCATAGACAATGTGCTGAACACACTCAGAATAGAAGTCAGCGACGTCACCATCACACTCTCAGCCAGGTAATCAACATTTCCAAAATGGTTTGCACACATCTGTATTGTCATTCACTGTCATAGTCACGTTTACGGCTTCTTTCTGTGCACGTCAGCTCTTTAGGAGAAAGAGAAGACTGGTTTCACACACTGAGTCGGGCTATCGCTGATCACGCCGCAGGCCTCAATACCTTCAGCAGCTCCAGCGAGGTGTGAGGAAATCATCATATCTTTATCCATTAGTACTCATTATTAAGAAGGAATAGTATGGCATTCTGCATCCCTGTGCATGTTTGCAGGCCAGAGAGAAGCTGTGGATGTCATTGGGAGAAGCTGCTCCTGTTCTGGTTCCTGTGTCTCATGTGATGATGTGCATGAACTGCACGTCTGACTTCAGTCTAACACTGCGACGGCATCACTGTAATGCATGCGGAAAGG[T/A]GAACATTTTTTACACAGAGTACATTTGGGTTCACAGATTTGATGTCCATTTGCTTATTTTCACTTCATCCAAGATTTTTGTTTTTGGTAAAACACTAAAGATTTTTATGCAGAACTGTGGAGCTTGGTTGTTTAAAAAACTAAAAACTATGGAGACTGTCACTTTGAGAGTCAAAAAATACAGTCACAGTTTAAATGAAGTGAGTTTTAAAGATGCAATAGGAGACTTTGGGAAATGCCCATAGCCCTGCAAGTCAGCATTCAATGACATGCCTCCTGGACACATGAACGAGCAAGCACTAGACAGCATGACTTGCGAAACCAAACCTAAAAAAGAAAGTAAGTTGGTAATAAATTTTTTTTGTCTGAACCATGCACCGATGACATAATACTTTCTGCACAATCAGGATGTGGAGAGGTATGTAATTATATATTTTGATGGCAGGCGAAAGGTAGGACAGCCTATTGTAATGTTTTGACCGATTGTTTTAATTGAACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35058
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103945 Nonsense 482 534 15 16
Genomic Location (Zv9):
Chromosome 11 (position 18820222)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18237536
GRCz11 11 18399878
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAAATGTCTGCGTCTGCAGGATAAAGTGGCATCTGAAAGTCTTTCACTG[C/T]AGGGTTTTACTGTGAAGCTGTCGGATCGATCAGAGGGTGAAGACACAGAC
Long Flanking Sequence:
TTCATGACTTTATATTCTATACTGTACATCATTTCTGTTAACTGACAAGACTTTTGTCTAAGCAAAGTCAGACCTTCCTGTCCTAATTAAATAATTACAAATCAAGGCATGATCATATTTTATTTTGGTAAAATAAGCGTGATCTAGAGGCCTTTGCCTTTCTTTTGAGCCATTTCTGATACCAAATGATCAACTAGAAGTAAAGTTAGTATTTGTTATTTCTAAAACTTGGATAGGTGACAAGACTTTTGTCAGATAGTGTATGTATATGGAAATCAGATTTCATTTTATTACATCACACTGTCTGAACTGATAAACTGTACAGGTCTGGTACTAAAACAGCAAGGTTATGATACTTATCGTACCAGCATGTACATACTGTAGCACAATCCTTACACACATTTGACCTCTCTCTCACTCTTTCTCTCTCGCTCTCTCTCTCTTGTTCTCTCAAATGTCTGCGTCTGCAGGATAAAGTGGCATCTGAAAGTCTTTCACTG[C/T]AGGGTTTTACTGTGAAGCTGTCGGATCGATCAGAGGGTGAAGACACAGACAACGTCTTCCAGCTCTACCATAAAAAAACACTGTATTACACCTTCAGAGCGGACGACCAGCCCACTGCACGCAGGTAAAACACAAAACACTCCGCACTACCAAAATACATGCTTTAAAGCATCATACATTATTTAGGATTCTCCAGAAACATAATACAGAAATATATAATTTTGCAGGTGGGTAAACGCAATGGAAGAGGCCACAGTGTTATAGTATCCAGCGCTCTGTCCAGACGACTACAGAACTCTGCACAGAATCCCTAAACTCATTTGTGGGCTTCAATAAATGACTTCAGAGTCACCTGTGCCTGAGAAACCAGCGGAATCACACCATAAATACCTTTGTTTTTTTTTTATCTTTTTGGCTGCTGAATTAAATGACAATTACAAAAAAGGCATGTTTGTGCTGTTTCAGGACCAGTCCTACGCCTCGACTACTTCACCGACCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21880
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103945 Essential Splice Site 523 534 16 16
Genomic Location (Zv9):
Chromosome 11 (position 18819995)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18237309
GRCz11 11 18399651
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATTATTTAGGATTCTCCAGAAACATAATACAGAAATATATAATTTTGCA[G/T]GTGGGTAAACGCAATGGAAGAGGCCACAGTGTTATAGTATCCAGCGCTCT
Long Flanking Sequence:
CTTGGATAGGTGACAAGACTTTTGTCAGATAGTGTATGTATATGGAAATCAGATTTCATTTTATTACATCACACTGTCTGAACTGATAAACTGTACAGGTCTGGTACTAAAACAGCAAGGTTATGATACTTATCGTACCAGCATGTACATACTGTAGCACAATCCTTACACACATTTGACCTCTCTCTCACTCTTTCTCTCTCGCTCTCTCTCTCTTGTTCTCTCAAATGTCTGCGTCTGCAGGATAAAGTGGCATCTGAAAGTCTTTCACTGCAGGGTTTTACTGTGAAGCTGTCGGATCGATCAGAGGGTGAAGACACAGACAACGTCTTCCAGCTCTACCATAAAAAAACACTGTATTACACCTTCAGAGCGGACGACCAGCCCACTGCACGCAGGTAAAACACAAAACACTCCGCACTACCAAAATACATGCTTTAAAGCATCATACATTATTTAGGATTCTCCAGAAACATAATACAGAAATATATAATTTTGCA[G/T]GTGGGTAAACGCAATGGAAGAGGCCACAGTGTTATAGTATCCAGCGCTCTGTCCAGACGACTACAGAACTCTGCACAGAATCCCTAAACTCATTTGTGGGCTTCAATAAATGACTTCAGAGTCACCTGTGCCTGAGAAACCAGCGGAATCACACCATAAATACCTTTGTTTTTTTTTTATCTTTTTGGCTGCTGAATTAAATGACAATTACAAAAAAGGCATGTTTGTGCTGTTTCAGGACCAGTCCTACGCCTCGACTACTTCACCGACCAATTCAAAAAGTGCCAAATGTAAAAAACAGTGCAGTTCGGTGAAGCTCAGATGTTTCCAAACCACTCATCTGCATCTGATAAAGGAGAATGTTTGTTTTTTGTTCTGTTTTCAGAATCTCAGCAACCTTTCTATATGCAGATATAATTGAGAGCTGTCATTTTATATATTCATGTAAAATTAACAAATAAATGAAGTACAGTTCAGGTGAATAGGCTTGTTATAGACAA
Associated Phenotype:
Not determined