Busch Lab

ZMP

LOC100150844

Ensembl ID:
ENSDARG00000070651
Human Orthologue:
PRKCD
Human Description:
protein kinase C, delta [Source:HGNC Symbol;Acc:9399]
Mouse Orthologue:
Prkcd
Mouse Description:
protein kinase C, delta Gene [Source:MGI Symbol;Acc:MGI:97598]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa10046 Nonsense Available for shipment Available now
sa15723 Nonsense Available for shipment Available now
sa35057 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa10046
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103943 Nonsense 103 685 2 15
Genomic Location (Zv9):
Chromosome 11 (position 18788814)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18206128
GRCz11 11 18368470
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCYGTCATTGCTGAACGCTGTAAAAAAGGCAACGGGCATGCAGAGTTYWG[G/A]GTGGACCTGCAGCCCTCGGGGAAGGTGAKGATGTCCGTCCAGTTTTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15723
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103943 Nonsense 408 685 10 15
Genomic Location (Zv9):
Chromosome 11 (position 18779021)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18196335
GRCz11 11 18358677
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGATGTGGWGCTGATGGATGATGATGTGGAGTGTAYAATGGTGGAGAAA[C/T]GAGTGTTAGCTTTAGCCTGGGAAAACCCTTTCCTCACACACCTCTAYTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35057
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103943 Essential Splice Site 429 685 10 15
Genomic Location (Zv9):
Chromosome 11 (position 18778955)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18196269
GRCz11 11 18358611
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTGGGAAAACCCTTTCCTCACACACCTCTATTGCACTTTTCAGTCAAAG[G/A]TGAGTGTTGATGTAAAATAAAATCATGTGCTGCCATTCTTAACTTTGATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4415
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103943 Nonsense 623 685 14 15
Genomic Location (Zv9):
Chromosome 11 (position 18773065)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18190379
GRCz11 11 18352721
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCGTGGACATGCTTTCTTCAAGACAATCAACTGGCCAGCGCTGGAGAAA[C/T]GAGAGGTGTCWCCTCCGTTCAAGCCAAAAGTGGTACGATTCTGATCTCAT
Associated Phenotype:
Not determined