Busch Lab

ZMP

si:dkey-117n22.2

Ensembl ID:
ENSDARG00000070624
ZFIN ID:
ZDB-GENE-100921-51
Description:
LOC100003278 protein [Source:UniProtKB/TrEMBL;Acc:A2VCY5]
Human Orthologue:
CACNG7
Human Description:
calcium channel, voltage-dependent, gamma subunit 7 [Source:HGNC Symbol;Acc:13626]
Mouse Orthologue:
Cacng7
Mouse Description:
calcium channel, voltage-dependent, gamma subunit 7 Gene [Source:MGI Symbol;Acc:MGI:1932374]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa22780 Nonsense Available for shipment Available now
sa36063 Nonsense Mutation detected in F1 DNA Not yet available
sa22779 Nonsense Available for shipment Available now
sa11809 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22780
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103891 Nonsense 198 346 5 5
ENSDART00000133735 Nonsense 225 373 6 6
Genomic Location (Zv9):
Chromosome 16 (position 14715477)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 13073936
GRCz11 16 12964056
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCTCTTGTTGTCTCGATGTTGTCCAGGGCGCTGGTGTGATGTCAGTGTA[T/A]CTTTTCATGAAGCGTTATGCAGAGGAGGAGATGTATCGGCCTCACCCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36063
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103891 Nonsense 210 346 5 5
ENSDART00000133735 Nonsense 237 373 6 6
Genomic Location (Zv9):
Chromosome 16 (position 14715441)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 13073900
GRCz11 16 12964020
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGATGTCAGTGTATCTTTTCATGAAGCGTTATGCAGAGGAGGAGATGTA[T/A]CGGCCTCACCCCACTCTCTATCGCCCCCGTCTTTCCGAGGGCAGTGACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22779
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103891 Nonsense 217 346 5 5
ENSDART00000133735 Nonsense 244 373 6 6
Genomic Location (Zv9):
Chromosome 16 (position 14715420)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 13073879
GRCz11 16 12963999
KASP Assay ID:
2260-9347.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGAAGCGTTATGCAGAGGAGGAGATGTATCGGCCTCACCCCACTCTCTA[T/G]CGCCCCCGTCTTTCCGAGGGCAGTGACTACAGCGGTCAGTATCTTCACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11809
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103891 Nonsense 231 346 5 5
ENSDART00000133735 Nonsense 258 373 6 6
Genomic Location (Zv9):
Chromosome 16 (position 14715378)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 13073837
GRCz11 16 12963957
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTCTCTATYGCCCCCGTCTTTCCGAGGGCAGYGACTACAGCGGTCAGTA[T/A]CTTCACCCAGAGACCTGGCCTCCACCTCAGCGAGCACGCAGCGCCTCTGA
Associated Phenotype:
Not determined