Busch Lab

ZMP

LOC799449

Ensembl ID:
ENSDARG00000070590
Human Orthologue:
NT5C1A
Human Description:
5'-nucleotidase, cytosolic IA [Source:HGNC Symbol;Acc:17819]
Mouse Orthologue:
Nt5c1a
Mouse Description:
5'-nucleotidase, cytosolic IA Gene [Source:MGI Symbol;Acc:MGI:2155700]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa36498 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4726
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103830 Nonsense 149 358 4 6
Genomic Location (Zv9):
Chromosome 17 (position 43593036)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43557711
GRCz11 17 43548249
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTTTTTTAGAACGCTTTTGTATGACTGGAGGCAACAGTCCTATTGGTTA[T/A]CTGAAAGCTTACCACACCAACCTTTATCTGTCAGCTGACTCRCTGAAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36498
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103830 Essential Splice Site 173 358 4 6
Genomic Location (Zv9):
Chromosome 17 (position 43592964)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43557639
GRCz11 17 43548177
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTTATCTGTCAGCTGACTCGCTGAAAGTCAGAGAAGCCATCGAAGCAGG[T/C]GAGCTGGAGTGCTTTTGGGAATTAATTAAGGGAATAATATATAAATACAC
Associated Phenotype:
Not determined