Busch Lab

ZMP

A1L2A0_DANRE

Ensembl ID:
ENSDARG00000070583
Description:
LOC100148744 protein [Source:UniProtKB/TrEMBL;Acc:A1L2A0]
Human Orthologue:
ITPK1
Human Description:
inositol 1,3,4-triphosphate 5/6 kinase [Source:HGNC Symbol;Acc:6177]
Mouse Orthologue:
Itpk1
Mouse Description:
inositol 1,3,4-triphosphate 5/6 kinase Gene [Source:MGI Symbol;Acc:MGI:2446159]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa5904 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa23161 Nonsense Available for shipment Available now
sa36494 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa36493 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa5904
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103799 Essential Splice Site 157 159 6 6
ENSDART00000124043 None None 367 None 8
Genomic Location (Zv9):
Chromosome 17 (position 43385741)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43350416
GRCz11 17 43340954
KASP Assay ID:
554-3644.1 (used for ordering genotyping assays)
KASP Sequence:
TTTAGTATGCTTTTCTCTTAATCTAGTAGCCAWTTAMAACATTTTCAGCC[A/C]AAAACAAAAATATTTTTCTCAGTTTTGCCTYTTTTGTTTACATGACACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23161
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103799 None None 159 None 6
ENSDART00000124043 Nonsense 161 367 5 8
Genomic Location (Zv9):
Chromosome 17 (position 43353909)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43318584
GRCz11 17 43309122
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGCCCCCGTGTGTCATTCAGAGTTTTATAAACCACAATGCCGTGCTGTA[T/G]AAGGTGTTTGTGGTGGGCGAGTCGTATACTGTGGTGGAAAGACCATCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36494
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103799 None None 159 None 6
ENSDART00000124043 Essential Splice Site 187 367 5 8
Genomic Location (Zv9):
Chromosome 17 (position 43353831)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43318506
GRCz11 17 43309044
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTGTGGTGGAAAGACCATCACTCAAGAACTTCCCATCTGGACCGTCTGG[T/G]AAACCTTCAACTCACACTTCAACTCTTTCGAAACGTTATTTCCATGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36493
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103799 None None 159 None 6
ENSDART00000124043 Nonsense 218 367 7 8
Genomic Location (Zv9):
Chromosome 17 (position 43347309)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43311984
GRCz11 17 43302522
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCCTCTTTGGTTTGTATTTTGACAGAGAGATAATGTAGAAGGTGTTTCC[C/T]AGCCACCAAACGATGATGTCATCAGGGAACTGTGCAAGTCTCTGCGGGAA
Associated Phenotype:
Not determined